ID: 1157646005

View in Genome Browser
Species Human (GRCh38)
Location 18:49272169-49272191
Sequence GTAACTTACCACTTCATGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157646005 Original CRISPR GTAACTTACCACTTCATGAA TGG Exonic
907220746 1:52905294-52905316 GTGACTTACAACTCCATCAAAGG - Intronic
911905507 1:103563650-103563672 GGAATTTAGCACTGCATGAAAGG - Intronic
915056852 1:153140973-153140995 GAAAATAACCACTTCATGAAAGG + Intergenic
915935285 1:160087082-160087104 ATAGCTCACCACTTCATAAAGGG - Intronic
919547145 1:198938156-198938178 TTAATTTACCACTTTATGTAAGG + Intergenic
1068812633 10:61273872-61273894 GTTACTTACCAGTCCATGACTGG + Intergenic
1071734995 10:88288651-88288673 ATAAATTACCACCTCATGACTGG - Intronic
1073707809 10:106005857-106005879 TTAACTTAAAACTTCAAGAAAGG - Intergenic
1084117346 11:67049993-67050015 GAAACTTACCAGATCAAGAAAGG + Exonic
1088394800 11:109354934-109354956 GTCATTTACGACATCATGAATGG + Intergenic
1091393449 12:139448-139470 GTAACTTCCCACGTCATGCCAGG + Intronic
1098088160 12:66870798-66870820 GTATGTTACTACTTCATTAAAGG + Intergenic
1100713961 12:97286425-97286447 GTAACTTACCATTTCTTAAAGGG - Intergenic
1101234625 12:102776059-102776081 TTTACTGACCACTTGATGAATGG + Intergenic
1101401123 12:104387997-104388019 TTACCTTACCATTTGATGAAGGG + Intergenic
1105656485 13:22445860-22445882 GTAAGTAACCACTTAATAAAGGG - Intergenic
1109427438 13:62183854-62183876 GTAACTTACCACTTCCCAAATGG - Intergenic
1110578411 13:77088348-77088370 ATAACCTACCACTTCATGGATGG - Intronic
1111237153 13:85423960-85423982 CTAACTTTCCATTTCATTAAAGG + Intergenic
1111498402 13:89084820-89084842 GTATCTTACCTCGTGATGAAAGG - Intergenic
1112359450 13:98704335-98704357 GTAACTGACGACTTCAAGCAGGG - Exonic
1117237201 14:53790719-53790741 GTTACTTAACACTGCATAAATGG - Intergenic
1117539072 14:56729198-56729220 GTCACTGACCACTACATGACGGG + Intronic
1118859979 14:69655320-69655342 GTAACCTAAAAGTTCATGAAAGG - Intronic
1119879223 14:78086896-78086918 GTATCTTACCATTCCAAGAATGG - Intergenic
1120002745 14:79321934-79321956 GTGAATTAAGACTTCATGAAAGG + Intronic
1121748579 14:96324798-96324820 GTCAATTATGACTTCATGAAAGG - Intronic
1122092943 14:99352064-99352086 GTAGCTTGCCACTCCATGCAAGG - Intergenic
1125623745 15:41088578-41088600 TTTACTTACCACTTCCTGGATGG - Intronic
1126039295 15:44574980-44575002 GTTAGTTACCACTTCATTACTGG + Exonic
1126095782 15:45088969-45088991 GTAATTTTCCACTCCATGCAAGG + Intergenic
1131102688 15:89705605-89705627 GGAACTCACCACTTCATTGATGG - Exonic
1134379483 16:13710769-13710791 GTAATTTACCACTTCCCTAAGGG + Intergenic
1137918556 16:52460571-52460593 GTAACTTTCAGCTACATGAAAGG + Intronic
1141867220 16:86758816-86758838 GTAAGTTCCCACTTCTTGGAAGG - Intergenic
1145120914 17:20258771-20258793 GTTAGGTACAACTTCATGAAAGG - Intronic
1153657476 18:7296593-7296615 GAAACTTCCCAATTCATGACGGG - Intergenic
1156565090 18:38178993-38179015 TTAAGATACCACTTGATGAATGG + Intergenic
1156733317 18:40222753-40222775 GAAACTTACCAGTTTGTGAAAGG + Intergenic
1156860674 18:41832678-41832700 CTAACTCACCACTTCCAGAAGGG + Intergenic
1157646005 18:49272169-49272191 GTAACTTACCACTTCATGAATGG + Exonic
1162607539 19:11721977-11721999 GTAACTTAAAAGTCCATGAAAGG - Exonic
1162681814 19:12349977-12349999 GTAACTTAAAAGTCCATGAAAGG - Exonic
1163857033 19:19711376-19711398 GTCACTTTCGACTGCATGAAAGG - Exonic
929205366 2:39286012-39286034 CTTACTTACCACTTCAAGAAAGG - Intronic
937435578 2:121877837-121877859 GTTACTTATCACTTAATGACAGG - Intergenic
939585327 2:143997317-143997339 ATAACTTTCCACTTCATAATTGG - Intronic
939648813 2:144736823-144736845 CTAACATAACACTTCATGAGAGG - Intergenic
940503217 2:154520707-154520729 GTAATTTACCATAACATGAATGG - Intergenic
940763235 2:157761518-157761540 GTAATTTATCACTACATAAAGGG + Intronic
944682446 2:202089435-202089457 GTAACTGACCATCTCATCAAAGG - Intronic
945744160 2:213700541-213700563 GTTACTTACATCTTAATGAAGGG + Intronic
1169017171 20:2301367-2301389 GTGACTTCCCCTTTCATGAAGGG + Intronic
1171941235 20:31331728-31331750 GAAACTTACAACTTTAAGAAGGG - Intergenic
1184579009 22:45399949-45399971 GTAACCTCCCACTTCAACAATGG - Intronic
949604487 3:5638097-5638119 GAAGCTTACCATTTTATGAACGG + Intergenic
950402849 3:12783694-12783716 GTTACGTACCACTTCCTTAAGGG - Intergenic
950687281 3:14627616-14627638 GGAGGTTAGCACTTCATGAAAGG - Intergenic
950785934 3:15435634-15435656 TTAACTAACCATTTCAAGAAAGG - Intronic
950828526 3:15851234-15851256 GTAAGATACTACTTCATGACTGG + Intronic
953318255 3:41948636-41948658 GTAATATACCACATTATGAAGGG + Intronic
955328674 3:58029144-58029166 GTTAGTTACCACTACATAAAGGG - Intronic
959557851 3:107742971-107742993 GTAATTTACCTCCTCATAAATGG + Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
960225592 3:115164602-115164624 GTTTCTTACCACTCCAGGAAAGG + Intergenic
960341123 3:116476467-116476489 GTAACTTTCTATTTCATGATTGG - Intronic
960354009 3:116628858-116628880 GTATCTTTCCACTTGAGGAAAGG - Intronic
960468131 3:118024306-118024328 GCATCTTACCACATCAAGAATGG - Intergenic
965327683 3:167328000-167328022 TTGACTTAACACTTCCTGAAAGG + Exonic
965727876 3:171738608-171738630 GTATATTACCTCTTCAAGAAAGG + Intronic
967756183 3:193172095-193172117 GTAAGATACCACTTTATGACCGG + Intergenic
970763775 4:19522323-19522345 GGAACTTCCAACTTCATTAAGGG + Intergenic
970792100 4:19869764-19869786 GCAACTTTTCACTTGATGAACGG - Intergenic
974600376 4:64071866-64071888 GTAACCTACCACTTTAAGTAGGG + Intergenic
978839071 4:113187876-113187898 ATTATTTCCCACTTCATGAATGG - Intronic
980753232 4:137120152-137120174 GTAACTTGCAACAACATGAATGG + Intergenic
981162470 4:141514925-141514947 TTTTCTTACCATTTCATGAAGGG - Intergenic
981941791 4:150288813-150288835 TTAAGTTACCATTTCATGGATGG + Intronic
983555014 4:169052253-169052275 GTAATTTACCACATCATGGCTGG + Intergenic
983824669 4:172243690-172243712 GTAAATTCCCACTTCTCGAATGG - Intronic
986031490 5:3898077-3898099 TTATCCTACCATTTCATGAAAGG - Intergenic
986818576 5:11439691-11439713 GTAACATCCCAGTTCCTGAATGG - Intronic
990491665 5:56308836-56308858 ATAACTATCCACTTAATGAAGGG + Intergenic
992076563 5:73197745-73197767 GTAACCAACCCCTTCATCAAAGG + Intergenic
992458126 5:76934966-76934988 GTATCTTTTCACTTCATGAAAGG - Intergenic
993881801 5:93371633-93371655 TTATTTTACCATTTCATGAAAGG - Intergenic
997954582 5:138269092-138269114 CCAACTTACTACTTCAAGAATGG + Intronic
1003210446 6:4059552-4059574 GTCACTTACCACTTCAAGGTAGG + Intronic
1004737763 6:18424994-18425016 GTAATTTGCAAATTCATGAAGGG + Intronic
1008051184 6:46901891-46901913 GCAATTTACCACTCCATGTAAGG + Intronic
1009210251 6:60853969-60853991 ATAACTTAACATTTCTTGAAGGG - Intergenic
1010847312 6:80725071-80725093 GTAACTCATAACTTCATGCAAGG + Intergenic
1010926215 6:81749932-81749954 CTCATTTACCACTCCATGAAGGG + Exonic
1015352510 6:132238209-132238231 GTAATTTACCTCTGCATAAAGGG + Intergenic
1023167803 7:37360088-37360110 TTACCTTTTCACTTCATGAATGG + Intronic
1023282399 7:38584583-38584605 GTGACCTACCAGTTCAGGAATGG - Intronic
1025057988 7:55780427-55780449 TTAACGCACCACTTTATGAATGG - Intergenic
1025828456 7:65030046-65030068 TTAACTCACCACTTTTTGAATGG + Intergenic
1025915979 7:65866477-65866499 TTAACTCACCACTTTTTGAATGG + Intergenic
1027433448 7:78138236-78138258 GGAACTAAACACTTCATGAGTGG + Intronic
1028221104 7:88197811-88197833 CTAACTTAACCCTTTATGAATGG - Intronic
1029815560 7:103091019-103091041 GTAACTTACCACTTCAAATTAGG + Intronic
1030508054 7:110449495-110449517 CTAACTTCCCACTTCACGCAAGG - Intergenic
1031234931 7:119162898-119162920 GTATCTTACCAATACATGAATGG - Intergenic
1031390858 7:121212930-121212952 GCATCTTTCCACTTCATGCAGGG - Intronic
1035860570 8:3023643-3023665 GAAATTTACCACTTTTTGAAGGG - Intronic
1036017290 8:4799250-4799272 GTAGCTCACCAGTTCATAAAAGG + Intronic
1040714070 8:50225768-50225790 GACACTTGCCAATTCATGAATGG + Intronic
1043103544 8:76079222-76079244 GTAACCTAACAATTAATGAAAGG - Intergenic
1046277186 8:111978702-111978724 GTAAAATACCACTTCATAATGGG - Intergenic
1046472831 8:114701110-114701132 GTATCATATCACCTCATGAATGG - Intergenic
1048681858 8:136851504-136851526 GAATCTTACCACTGTATGAAAGG - Intergenic
1050737600 9:8781828-8781850 GTAACTTATCACATTGTGAAAGG + Intronic
1051862226 9:21639171-21639193 GTAACTTACAGCTTCAAGAAAGG + Intergenic
1053159289 9:35802421-35802443 GAAACTTACCACTACATAAGAGG - Intronic
1058395745 9:104551995-104552017 GTAACTTACCATCTCATACATGG - Intergenic
1060442891 9:123657594-123657616 GTGACTTTCCACTTCATACATGG + Intronic
1186601276 X:11040412-11040434 CTAACTTTTCACCTCATGAAAGG + Intergenic
1189181449 X:39008553-39008575 GTGACTTATCACATCTTGAATGG - Intergenic
1198140531 X:133798295-133798317 GTAAATTCCCACATGATGAATGG + Intronic
1199428409 X:147730638-147730660 GTAACTTACCATTTCAATCAGGG - Intergenic
1201270298 Y:12247513-12247535 TAAACTTACCACTGCATGGAGGG - Intergenic