ID: 1157654129

View in Genome Browser
Species Human (GRCh38)
Location 18:49368834-49368856
Sequence GGAAACTGCTTGTGTTAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157654123_1157654129 24 Left 1157654123 18:49368787-49368809 CCAAAGAAAGAGTTTCAAAAATG 0: 1
1: 1
2: 16
3: 91
4: 899
Right 1157654129 18:49368834-49368856 GGAAACTGCTTGTGTTAGACAGG 0: 1
1: 0
2: 0
3: 17
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157654129 Original CRISPR GGAAACTGCTTGTGTTAGAC AGG Intronic
901459085 1:9380924-9380946 GCAAAGTGCTTTTGCTAGACAGG - Intergenic
902219957 1:14958558-14958580 GGACACTGCATCTGTTAAACGGG - Intronic
906475176 1:46164727-46164749 GGAAACTACAGGTGTAAGACAGG - Intronic
907005147 1:50905532-50905554 GGAAACTGCAGGTGCTAGAGAGG - Intronic
909721514 1:78776214-78776236 GGAAACTGCCTGTCTGATACAGG + Intergenic
910702073 1:90086440-90086462 GGAAAATGCATGTGTGAGAGAGG + Intergenic
913052945 1:115132873-115132895 GGAAACTGCTTGTAGCAGACAGG + Intergenic
915251277 1:154590515-154590537 AGAAACAGCTTCTGTTTGACGGG - Intronic
916789072 1:168108982-168109004 GAAAACACCTTGTGTTAGATTGG + Intronic
919156632 1:193774595-193774617 GGAAAGAGCTTCTGTTAGTCTGG + Intergenic
921803375 1:219427607-219427629 TGAAACTGCCAGTGTTAGAGAGG + Intergenic
1064350598 10:14572909-14572931 GGAAACTCCTTGTTTTAGAGGGG - Intronic
1064690516 10:17912921-17912943 GGAAACAGTCTGTGTTTGACAGG + Intergenic
1065986506 10:30958753-30958775 GGAAACTGATTGAGTTAGCAAGG - Intronic
1073127590 10:101161365-101161387 GGAAACTGCTTGTGATTGTGAGG + Intergenic
1074036426 10:109743663-109743685 GGAAACCGTTTGTGTAGGACTGG + Intergenic
1074873067 10:117592757-117592779 GGAATCTGCTTATGTTACCCAGG + Intergenic
1076044860 10:127283667-127283689 GAAAAATGCTTGTGATAGAATGG - Intronic
1078479397 11:11662899-11662921 GCAAAGTGCTTGTCATAGACTGG - Intergenic
1080803604 11:35631909-35631931 GGAAACTGCCTTTGATAGAATGG - Intergenic
1080807259 11:35664497-35664519 AGAAACTGCTGGTGTTAATCGGG + Intronic
1084310645 11:68314177-68314199 GGAAACTGTTTGTTTTAAAGGGG + Intronic
1084358635 11:68655551-68655573 GGAAAGTGCTTTTGTCTGACTGG + Intergenic
1085223366 11:74895517-74895539 GGCAACTCCTAGTGTTAGGCTGG + Intronic
1085900072 11:80688264-80688286 GTAAACTATTTGTGTTAGTCAGG - Intergenic
1091205050 11:133815007-133815029 GAAAACAGCTTGTATTAGTCAGG + Intergenic
1092954429 12:13536798-13536820 GGAAACTGGTTTTGTGAGACGGG - Intergenic
1096805071 12:54135681-54135703 GGAACCTGTTTGAGTTAGAAGGG - Intergenic
1102129253 12:110512525-110512547 GGAAACTGCTTGTATTTCAAAGG + Intronic
1103609241 12:122111646-122111668 GGATAGTGCTTGTGTTTGAGTGG + Intronic
1104434306 12:128743557-128743579 GCAAGCTGGTGGTGTTAGACAGG - Intergenic
1109433804 13:62272562-62272584 GGAAACTGCTTAAGGCAGACTGG - Intergenic
1116831507 14:49724192-49724214 GATACCTGCTTCTGTTAGACAGG + Intronic
1119536442 14:75406621-75406643 GGGGACTGCGTGTGATAGACAGG + Intergenic
1122385983 14:101348629-101348651 GGAAGCTGCTTGTGGTGCACTGG - Intergenic
1123432064 15:20226336-20226358 GGAAAGTTCCTGTGTTAGTCAGG - Intergenic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1129556802 15:76518521-76518543 GGAAACAGCTAGTGATAGGCAGG + Intronic
1130554284 15:84911996-84912018 GGAAACTGCTGGTGTTTCGCTGG - Intronic
1133359117 16:5159723-5159745 GGAAATCGCTGGTGTTAGAAGGG + Intergenic
1133553156 16:6878575-6878597 GGACACTGCATGTGTCAGTCAGG - Intronic
1133675820 16:8070769-8070791 GGAATCTGATTGTGTTTGACAGG + Intergenic
1135161668 16:20102034-20102056 AGACACTGCTTGTGTTTGAAAGG - Intergenic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1137526058 16:49237373-49237395 GGAAACTACATGTTTTTGACAGG + Intergenic
1138560200 16:57796861-57796883 GGAAAATGCTTTTGTTTTACCGG + Intronic
1141620350 16:85234002-85234024 GGAATCTGCTTTTGTTATATAGG - Intergenic
1142664278 17:1453608-1453630 AAAAAATGGTTGTGTTAGACTGG + Intronic
1142965533 17:3578575-3578597 GAAAACTGCTTCTCTTAGGCAGG + Intronic
1143575215 17:7788312-7788334 GGAAACGGCGTGTCTGAGACAGG + Intronic
1153185406 18:2480528-2480550 GGCAAGTGCTTGTGTGAGAAGGG + Intergenic
1156189226 18:34699098-34699120 GGACACTCCTTGTATTAGTCAGG + Intronic
1157654129 18:49368834-49368856 GGAAACTGCTTGTGTTAGACAGG + Intronic
1157972265 18:52284132-52284154 AGGACCTACTTGTGTTAGACAGG + Intergenic
1158873910 18:61714449-61714471 GGAAACTTCTCAGGTTAGACAGG + Intergenic
1164889488 19:31811029-31811051 GGAAACTGCTGCTGTAAGACAGG + Intergenic
927369810 2:22341535-22341557 TGAAACTGTGTGTGTTGGACAGG - Intergenic
927632631 2:24787693-24787715 GGAAACTTCTTTTCTGAGACTGG - Intergenic
928789059 2:34929168-34929190 TCAAACTGCTTTTGTTAAACAGG + Intergenic
934781091 2:96970187-96970209 GGAAACTACTTATGGCAGACAGG + Intronic
936069240 2:109354235-109354257 GGATACTGCCTGTGTCAGGCTGG + Intronic
941231999 2:162921754-162921776 TGAAACTGCTTATGTTCAACAGG - Intergenic
942230454 2:173856594-173856616 GGAAACTGCTGGTCTAATACAGG - Intergenic
942521288 2:176806985-176807007 GGAAACAGTTTGTGATAGGCAGG - Intergenic
944883024 2:204034379-204034401 GGAAAGTGCTTGTTTTTCACTGG - Intergenic
945654257 2:212604682-212604704 GGCAGCTCCCTGTGTTAGACTGG - Intergenic
1170669036 20:18413357-18413379 GGAAATTGCTTGTAATATACTGG - Intronic
1183776977 22:39972654-39972676 GGACACTGCTTGTGCTACACTGG - Exonic
951264478 3:20550187-20550209 GGTAACTGCTGGTGTTAGTAGGG - Intergenic
953043274 3:39273642-39273664 GGAAACTGTTTGTTTGAGACAGG + Intronic
955649106 3:61174104-61174126 GGAAACTGCAGGTGTTAGAAAGG + Intronic
962793157 3:138829624-138829646 GAAAACTGCTAGGGTTAGCCGGG + Intronic
964347122 3:155765251-155765273 GGAAACTGATTGTCTTGGTCAGG - Intronic
965124533 3:164608479-164608501 GGAATCTACTTGTTTTAGCCAGG - Intergenic
967136691 3:186518487-186518509 GGAAACTGTTTGGGTTTGCCTGG - Intergenic
969804700 4:9598054-9598076 GGAAATCGCTAGTGTTAGAGGGG - Intergenic
970174360 4:13323714-13323736 GGAAAATGCTTTTCTAAGACTGG + Intergenic
984515370 4:180732530-180732552 GGAACCTTCTGGTGTGAGACAGG + Intergenic
985126577 4:186700918-186700940 GGAAACAGCTTACGTCAGACAGG - Intronic
985702811 5:1383724-1383746 GGAATGTGATTGTGTTACACAGG - Intergenic
985889421 5:2704259-2704281 GGAAAGTGTTCGTATTAGACGGG + Intergenic
986833374 5:11607075-11607097 GGAACCTGCTTCTGTAAGCCAGG + Intronic
992937502 5:81724567-81724589 GCAAACTGCTTGTATTCTACAGG + Intronic
994088729 5:95789046-95789068 GAAAACTTCTTGTGTAACACAGG - Intronic
994506773 5:100652415-100652437 GGAAACTGTCTGTGGAAGACTGG - Intergenic
998013863 5:138716864-138716886 GGAATCTGCTTGTAAAAGACAGG - Intronic
1000357377 5:160412795-160412817 GGCAACTGCTTGTTTTTGTCAGG - Intronic
1004157157 6:13180186-13180208 GGAAACTGTTTCTGTTAGGTAGG + Intronic
1012353172 6:98278573-98278595 GTAAACTGGGTGTGTTAGTCAGG - Intergenic
1012579990 6:100855637-100855659 GGAAACTGCTTAGGTAAGTCAGG - Intronic
1015494566 6:133866396-133866418 GAAAACTGGTTGTGGTAGAGTGG - Intergenic
1015609766 6:135004052-135004074 GGAAACTGCATGTGCTACATTGG + Intronic
1020607451 7:10356762-10356784 GGTAACTCCTAGTGCTAGACTGG - Intergenic
1021807541 7:24372269-24372291 GGAAATTGGTTGTGTTAAATTGG - Intergenic
1027689060 7:81319298-81319320 GGAAACAGCTTGGATTAGATGGG - Intergenic
1030054292 7:105568996-105569018 GGAAAATGCTGGGGTTAGAGAGG - Intronic
1030515307 7:110531146-110531168 GGAAATTGTTTGTTTTAGACTGG + Intergenic
1030722048 7:112882084-112882106 GGAAGCTGCTTGTGGTACACTGG + Intronic
1032690093 7:134277069-134277091 GGAAACTCCTTTTGTTTGCCAGG + Intergenic
1039581042 8:38667040-38667062 GGAATCTGCTTGTTTCAGACTGG + Intergenic
1040066230 8:43146353-43146375 AGAACCTGCTTGAGTCAGACAGG - Intronic
1040115235 8:43609999-43610021 TAAAACTGCTTGGGTTTGACTGG + Intergenic
1043317910 8:78944160-78944182 GGAAACTGCTGCTATTTGACAGG - Intergenic
1046303448 8:112329228-112329250 GGAAACTGTTTATGTTTAACAGG - Intronic
1049142543 8:140968968-140968990 GCAAACTGCTTCTGTTACTCAGG - Intronic
1049668041 8:143856896-143856918 GGACACTCCCTGTGCTAGACTGG - Intergenic
1050139328 9:2501328-2501350 GGAAACTGCTTGTATCAGTCAGG + Intergenic
1051640960 9:19224270-19224292 GTAATCTGCATGTGGTAGACTGG - Intergenic
1054744153 9:68837172-68837194 GGCACCTGTTTGTGTTAGGCAGG + Intronic
1058351610 9:104031551-104031573 GGAAATTGCTTGTGCCAGATGGG - Intergenic
1062030190 9:134358717-134358739 GGAAACTGCTTGTCTCAGGCAGG - Intronic
1187524343 X:20040341-20040363 GGAAACAGCCTGTGTTAGTCAGG - Intronic
1193069985 X:77296975-77296997 GGATACTGCTTCTGTCTGACTGG - Intergenic
1195366284 X:104129365-104129387 GGAAAATACATGTGTTAGATAGG - Intronic
1195865496 X:109428550-109428572 GCAAACTGAATGTGTGAGACTGG + Intronic
1196900223 X:120375332-120375354 GGCAACAGGTTATGTTAGACAGG - Intronic
1197449779 X:126597650-126597672 GGAAACTGGATAAGTTAGACAGG - Intergenic
1198104463 X:133449058-133449080 TGAAACAGATTGTGTTTGACTGG + Intergenic
1202256388 Y:22925261-22925283 GGAAACTGCATGTGTTGGAGAGG + Intergenic
1202409378 Y:24559014-24559036 GGAAACTGCATGTGTTGGAGAGG + Intergenic
1202461403 Y:25111064-25111086 GGAAACTGCATGTGTTGGAGAGG - Intergenic