ID: 1157660666

View in Genome Browser
Species Human (GRCh38)
Location 18:49439542-49439564
Sequence ATTTCTCTTTAGCAGTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157660666_1157660667 9 Left 1157660666 18:49439542-49439564 CCAGCATACTGCTAAAGAGAAAT 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1157660667 18:49439574-49439596 AATACTTGCTGAAATAGCCAAGG 0: 1
1: 0
2: 4
3: 13
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157660666 Original CRISPR ATTTCTCTTTAGCAGTATGC TGG (reversed) Intronic
900824125 1:4912651-4912673 ACATCTCTTTGGGAGTATGCAGG - Intergenic
900848527 1:5123206-5123228 ATTTCTCTTTATCAATACCCAGG + Intergenic
907288028 1:53394486-53394508 ATCTCTCTGTGGCAGCATGCAGG - Intergenic
908035655 1:60049289-60049311 ATTTCTCATTAGCAAAATCCAGG - Intronic
917938162 1:179890108-179890130 ATTTTTTGTTAGCAGTATACTGG - Intronic
918641609 1:186847850-186847872 ATTTGTCTTCTGCAGTAGGCTGG + Intronic
920591900 1:207228049-207228071 TTTTCTCTTTAGCAAAATGGAGG + Intergenic
921266451 1:213424707-213424729 ATTTCTCTTGGGCATTTTGCAGG + Intergenic
921678883 1:218008270-218008292 ATTTCTCCTTACCATTATGTTGG + Intergenic
923760616 1:236840190-236840212 ATCTCTCTTTTGCAGTCTTCTGG - Intronic
924333191 1:242961230-242961252 ATTTCTATTTAACATTGTGCTGG - Intergenic
924760274 1:246978095-246978117 ATTTCTCTGTAGCAGAACACAGG + Intronic
1062967948 10:1624734-1624756 ATTACTCATTACCAATATGCAGG + Intronic
1064618543 10:17190987-17191009 ATGTCTCTTTAGCAGCAACCTGG + Intronic
1066609560 10:37226794-37226816 ATTTTTCATTAGCAGTATGAGGG + Intronic
1073066446 10:100762252-100762274 ATTTCTCTCCAGCAGTTTGAGGG + Intronic
1074404782 10:113171511-113171533 ATTTCTCTTTGGGATTCTGCTGG + Intergenic
1074883395 10:117675970-117675992 ATTGCTCTTTAGTATTATGGTGG - Intergenic
1075535390 10:123267365-123267387 TTTTCTCTTTACCAGTTTTCAGG + Intergenic
1076767552 10:132644796-132644818 ATTTCACTTGAGCAGGATGAGGG - Intronic
1077953705 11:6990222-6990244 ATTTCTTCGTAGCAGTATGTTGG + Intergenic
1078986075 11:16599908-16599930 ATTTCTTTTTACCAGAATGATGG - Intronic
1079649975 11:22915695-22915717 ATTTATCTTTATAAGCATGCAGG + Intergenic
1079827377 11:25214084-25214106 ATTTCTTCGTAGCAGTATGAGGG + Intergenic
1081046954 11:38286781-38286803 ATTTCTATTTAACATTATCCTGG + Intergenic
1081092214 11:38886192-38886214 ATTTCTCTTTTGCAAAAAGCAGG - Intergenic
1081233758 11:40619727-40619749 ATTTCTGTTTAGCAGCCTGGAGG - Intronic
1084351602 11:68604521-68604543 ATTTGTCTTCAGCACTGTGCTGG + Intronic
1086975369 11:93126124-93126146 ACTTCTATTTAGCATTGTGCTGG - Intergenic
1087666994 11:101061606-101061628 ATTTGTCTATAGCAGTATAAGGG + Intronic
1089361192 11:117887768-117887790 ACTTCTCTTAAGCAGATTGCAGG - Intergenic
1090347938 11:126085924-126085946 AATTCTCTTTACCAGAATGAAGG + Intergenic
1090511437 11:127379707-127379729 ATTTCCCTTTATTAGTATGCTGG + Intergenic
1090973390 11:131661581-131661603 CTTTCTCTTTAGCATGAGGCAGG + Intronic
1095468867 12:42515690-42515712 ATTTCTCTTTAGAACTTTGAGGG + Intronic
1097338858 12:58414985-58415007 ATTTATCTTTCACAGTATCCTGG + Intergenic
1100384355 12:94091762-94091784 TTTTGTCTTTAGCAGTCTGTGGG - Intergenic
1101298288 12:103449724-103449746 ATTTTTCTTCAGGAGTATCCTGG + Intronic
1105781477 13:23708444-23708466 TTTTGTCATTCGCAGTATGCTGG + Intergenic
1108116671 13:47136177-47136199 ATTTCTTTTTTGCAGTATCATGG - Intergenic
1108691044 13:52859517-52859539 ATTTATCTTTGGAAGTAGGCAGG + Intergenic
1112492355 13:99878863-99878885 ATTTCTCTTTAAAAATATTCAGG - Intronic
1113290095 13:108896016-108896038 ATTTCTCATTAGCAGTGTTGGGG + Intronic
1113445615 13:110364119-110364141 ATTTCTTTTTCTAAGTATGCTGG - Intronic
1114304372 14:21408150-21408172 ATTTTTGTATAGCAGTGTGCAGG - Intronic
1115099484 14:29681048-29681070 GTTTCTCATTTGCAGTAAGCTGG - Intronic
1115922832 14:38395744-38395766 AGTTCTCCATAGCAGTTTGCTGG + Intergenic
1116840097 14:49811468-49811490 ATTTCTATTTAACATTATACTGG - Intronic
1120066708 14:80049674-80049696 ATTTCTTTTCAACATTATGCTGG + Intergenic
1121848875 14:97200812-97200834 TTTTCTCATTTGCAGAATGCGGG + Intergenic
1123155277 14:106218815-106218837 ATTTCTCTTTAACAGCATGAGGG + Intergenic
1123206708 14:106720509-106720531 ATTTCTCTTTGACAGCATGAGGG + Intergenic
1123211730 14:106767514-106767536 ATTTCTCTTTGACAGCATGAGGG + Intergenic
1202830467 14_GL000009v2_random:23325-23347 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1123401944 15:19995943-19995965 ATTTCTCTTTGACAGCATGAGGG + Intergenic
1123511285 15:21002607-21002629 ATTTCTCTTTGACAGCATGAGGG + Intergenic
1123693695 15:22861373-22861395 ATTTCTCTTCAGCAGCATCCTGG + Intronic
1124398065 15:29322585-29322607 TTTTATCTTTAGCTGTCTGCTGG - Intronic
1124656709 15:31515113-31515135 ATTTCTCTCTCCAAGTATGCAGG - Intronic
1125474764 15:40039422-40039444 ATTTATATTCAGCTGTATGCTGG + Intergenic
1126515783 15:49536026-49536048 ATTTCTCTTTAACACAGTGCTGG + Intronic
1128739218 15:70072213-70072235 ATTTCCCTTAAGTAGTATTCAGG - Intronic
1130234808 15:82124324-82124346 TTTTCTCCTTTGCAGTAGGCAGG - Intergenic
1140494214 16:75369432-75369454 AATTCTGTATAGCAGTGTGCGGG - Intronic
1140831081 16:78751969-78751991 AATTCTCTTTAGAAGTATTGTGG - Intronic
1141248112 16:82329733-82329755 ATTTCTCCTCAGCAGAATGAGGG + Intergenic
1142520634 17:502290-502312 ATTTCTCTGTATCTGTATGTGGG - Intergenic
1143590184 17:7881105-7881127 TTTTCTCTGGAGCAGTATCCAGG + Intronic
1143753523 17:9049620-9049642 ATTACTCTTTAGGACTATGAAGG + Intronic
1144465330 17:15492719-15492741 ATTTCTCTTTGGGAGTCTGGGGG - Intronic
1145970272 17:28952060-28952082 TTTTCTCTTTACCAATATGGTGG - Intronic
1146029998 17:29358055-29358077 ATTTCTCTTGAGCAGTACCTAGG + Intergenic
1149251947 17:54780237-54780259 ATTTCTCCTTAGGACTATGTAGG - Intergenic
1150630805 17:66879134-66879156 ATTCCTCTTGAGAAATATGCTGG - Intronic
1153396894 18:4632766-4632788 AACTCTCTTTAGCTGTAAGCTGG - Intergenic
1156747395 18:40408950-40408972 TATTCTCTTCAGCACTATGCTGG + Intergenic
1156858029 18:41805620-41805642 ATTTCTGTTCAGCAGTACGGAGG + Intergenic
1156980648 18:43283978-43284000 ATTTTTTTTTAACTGTATGCTGG - Intergenic
1157660666 18:49439542-49439564 ATTTCTCTTTAGCAGTATGCTGG - Intronic
1158111832 18:53948380-53948402 TTTTCTCTTTTACAGTATTCAGG - Intergenic
1166744971 19:45137305-45137327 ATTACTCTTCAGCAGTATAAAGG + Intronic
1202642226 1_KI270706v1_random:104454-104476 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
927236784 2:20882188-20882210 ATTTCTCTTTGGAATTATGGCGG - Intergenic
929038105 2:37715315-37715337 ATTTGGCATTGGCAGTATGCTGG + Intronic
931012435 2:57932276-57932298 ATTTCTCTTTAGATGTCTGATGG + Intronic
931441217 2:62292085-62292107 ATTTCTCTCTACCAATAAGCAGG - Intergenic
933239039 2:79898621-79898643 ATTTCTCATTAGGAGAATGAAGG + Intronic
934168726 2:89321242-89321264 TTTTCTCTTTAGCAGTGAGTAGG + Intergenic
934198564 2:89861341-89861363 TTTTCTCTTTAGCAGTGAGTAGG - Intergenic
934790862 2:97058947-97058969 TTGACTCTTTAGCAGTATGTGGG - Intergenic
934815590 2:97323583-97323605 TTGACTCTTTAGCAGTATGTGGG + Intergenic
934818751 2:97353764-97353786 TTTACTCTTTAGCAGTAAGTAGG - Intergenic
934822105 2:97384900-97384922 TTGACTCTTTAGCAGTATGTGGG - Intergenic
935151142 2:100437406-100437428 ATTTCTATTCAACATTATGCTGG + Intergenic
935420769 2:102866484-102866506 ATTTGTTTTTAACACTATGCTGG + Intergenic
937744070 2:125389844-125389866 ATTTTTATTTAGAAATATGCAGG + Intergenic
937755906 2:125538418-125538440 ATCTCACTTTAGCAACATGCTGG + Intergenic
939507110 2:143058966-143058988 TTTTCTCTTTCCCAGTATGTGGG + Intergenic
940657975 2:156511582-156511604 ATTTCTCTTCAGCATCATGATGG + Intronic
943640781 2:190355417-190355439 ATTTTTCTTTACCTCTATGCTGG - Intronic
944708833 2:202317660-202317682 TTTTCCCTTTAGCCGTCTGCAGG + Intergenic
946146708 2:217736517-217736539 GTTTCACTTTAGCAATATACTGG - Intronic
948278311 2:236727172-236727194 ATTTCTCTTTATCAGGTTGAGGG + Intergenic
948964546 2:241367327-241367349 ATTTCTCATTAGCAGTTTGAAGG + Intronic
1169237980 20:3947670-3947692 ATTTCTCTTTAGCAATCTGTTGG + Intronic
1169877315 20:10312193-10312215 ATTTCTCTGTAGCAGTGTTTTGG - Intergenic
1173270858 20:41533402-41533424 CTTCCTCTTCAGCAGTATACAGG + Exonic
1174750933 20:53110905-53110927 CTTTCTCTTTAGATGTCTGCTGG - Intronic
1176609653 21:8868163-8868185 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1176940802 21:14922725-14922747 ATTTCTCTTCAGTAGTGTGTTGG + Intergenic
1177247989 21:18555181-18555203 ATTTCTCTTTAGCATTGTAGTGG + Intergenic
1178674138 21:34616351-34616373 ATTTCCCTTTCACAGTATGACGG - Intergenic
1180359708 22:11877395-11877417 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1184866434 22:47204235-47204257 ATTTTTCTTTGGCATTATTCCGG + Intergenic
950109434 3:10409261-10409283 ATTTCTCTTTACGAGAATTCTGG - Intronic
951079118 3:18430359-18430381 ATTTGTATTTAGCAGTATACAGG - Intronic
951182577 3:19676205-19676227 ATTTTTGTTTACCATTATGCAGG - Intergenic
953005444 3:38973898-38973920 ATCTCTCTTTAGAAGGAGGCTGG + Intergenic
956120440 3:65960708-65960730 ATTTCCCTTGAGCAGACTGCAGG + Intronic
958852910 3:99350277-99350299 ATTTTCCTTTATCAGTATGTGGG - Intergenic
959173511 3:102874385-102874407 ATTTCTCCCTAGCAGAAAGCAGG - Intergenic
959557413 3:107737988-107738010 ATTTCCCTTTAGCATTATGTTGG + Intronic
959654795 3:108790840-108790862 ATTACTTTTTAGCAGTATATTGG + Intergenic
960343925 3:116509082-116509104 ATTTCTCTTAAGCAGCAAGGGGG - Intronic
964832517 3:160900867-160900889 ATTTAGATTTAGCAATATGCAGG - Intronic
1202736335 3_GL000221v1_random:2932-2954 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
970072170 4:12172880-12172902 ATTTGTCTTTAGCACTGTCCAGG - Intergenic
970239874 4:13997629-13997651 ATTACTCTTTAGAAGTGTGAAGG - Intergenic
971801467 4:31298132-31298154 ATTTCTATTTAGCATTATACTGG - Intergenic
976480449 4:85537724-85537746 ATTTTCCTTTAGTGGTATGCTGG - Intronic
976677781 4:87722551-87722573 ATCTATCTTTTGCAGTATCCCGG - Intergenic
976811112 4:89102124-89102146 ATTCCTCTTTTGAAGTATGCAGG - Intronic
976981335 4:91234500-91234522 ATTTATATTTTGCAGAATGCAGG + Intronic
977661635 4:99594711-99594733 ATTTCCCTTTGGTATTATGCAGG + Exonic
979785005 4:124705491-124705513 ATTTCTTGTTAACAGTCTGCAGG - Intronic
980903479 4:138927280-138927302 ATGTCTCTTTAGCAGTTTCCTGG - Intergenic
984738054 4:183129915-183129937 TTTTCTCTTCAGCAGAGTGCAGG + Intronic
1202769598 4_GL000008v2_random:190334-190356 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
993612373 5:90071183-90071205 ATTTCTGGTTAGCAGTCTTCAGG - Intergenic
993987716 5:94617770-94617792 ATTTCTCTTTACAACTATTCTGG + Intronic
996088693 5:119329626-119329648 ATATCTGTTCAGCAGAATGCTGG - Intronic
996256386 5:121409313-121409335 TTTTTTCCTTAGCAGTATGCAGG - Intergenic
996396581 5:123019584-123019606 AGTGCTCTTTAGCAGTTTTCTGG - Intronic
996914385 5:128694731-128694753 ATTTCTCTTTAGCCGTCCACTGG + Intronic
999719647 5:154389932-154389954 AGTTCTCATTAGTAGGATGCAGG - Intronic
1000574339 5:162957762-162957784 ATTTCTTTCCAGCATTATGCTGG + Intergenic
1000686689 5:164258553-164258575 ACTTCTATTTAGCATTATACTGG - Intergenic
1001022102 5:168191640-168191662 ATTTCTCTTTAGCCTCATTCAGG + Intronic
1004656312 6:17665382-17665404 ATTTCTCTTTACCTGTAAGGTGG - Exonic
1005358404 6:25007539-25007561 GTTTCACTTTACCAATATGCAGG + Intronic
1005941346 6:30562551-30562573 ATTTCTCTGTAGCCCTATGATGG + Exonic
1006671593 6:35732681-35732703 CATTCTCTTTACCAGTATCCTGG - Intergenic
1008227833 6:48943865-48943887 ATTTGTATTTTGTAGTATGCTGG + Intergenic
1008791182 6:55236543-55236565 ATTTCTATTTAGCATTGTGCTGG - Intronic
1009682894 6:66921994-66922016 ATTTGTCATGAGCAGCATGCAGG - Intergenic
1012304679 6:97638915-97638937 ATTTTTTTTTTGCAGTTTGCTGG + Intergenic
1014786186 6:125622110-125622132 GTTTCTCTTTTGCATTCTGCAGG + Intergenic
1014940711 6:127435270-127435292 CTATCTCTTTAGTAGTATTCTGG + Intergenic
1016681640 6:146836398-146836420 ATTTCTTTTGAGCATTATGTTGG + Intergenic
1016724602 6:147347934-147347956 ATTTCTGGTTAGCAGGATGTTGG + Intronic
1016996965 6:149967567-149967589 ATTTATATCTAGCAGTATCCGGG + Intronic
1017567412 6:155702316-155702338 ATTTCTATTTAACATGATGCTGG - Intergenic
1019852053 7:3569445-3569467 ATTTCTCTTGAGAAGTCTGGAGG + Intronic
1021301986 7:18984515-18984537 CTGTCCCTTTAGTAGTATGCTGG - Intronic
1022553404 7:31264857-31264879 ATTTCTCTTCAGCATTGTTCTGG - Intergenic
1026307460 7:69154455-69154477 ATTTCTAGTTATCAGAATGCAGG - Intergenic
1027396832 7:77765121-77765143 ATTTCACTTTAGAAAAATGCAGG + Intronic
1027721082 7:81742343-81742365 ATTTCACTATAGCAGAATGATGG - Intronic
1027727258 7:81823136-81823158 CTTTCTCCTTACCAGTATGAAGG + Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028979334 7:96949871-96949893 ATGTCTCTCTTTCAGTATGCAGG - Intergenic
1031205143 7:118747013-118747035 CTTTCTCTTTTGCAATATGCTGG - Intergenic
1031719682 7:125156916-125156938 ATTTCTCTGAAGCAGTACCCAGG + Intergenic
1031903365 7:127434432-127434454 ATTTCTTTATAGCAGTGTGATGG - Intergenic
1035710241 8:1707926-1707948 AATTCTATTTAGTAGCATGCAGG + Exonic
1036025531 8:4904376-4904398 ATTTCTCTTTCACAGTAGTCAGG + Intronic
1039262313 8:35785186-35785208 ATTTCTCTTCATCATAATGCTGG - Intronic
1040929295 8:52717076-52717098 AGTTTTCTTTAGGAGTATGGAGG + Intronic
1041603227 8:59748103-59748125 ATTTCTCTTTAACATTGTGTTGG + Intergenic
1041703878 8:60824349-60824371 ATTTCCTTTTAGCATTATGTGGG - Intronic
1041957394 8:63571153-63571175 ATCTCTCTGTATCAGTGTGCAGG + Intergenic
1043465436 8:80501920-80501942 ATTTCTGTTTAACAGTATGGTGG + Intronic
1044396460 8:91718893-91718915 ATTTCTCTACAGCACTATGGGGG - Intergenic
1047704128 8:127480660-127480682 ATGTCTCTTTAACAGTATTAAGG - Intergenic
1049375259 8:142286360-142286382 TTTTCTCTTTAGGAGTATTCTGG + Intronic
1050761213 9:9073595-9073617 ATTTCTATGTTGCAGTCTGCAGG - Intronic
1051534595 9:18142675-18142697 ATTTATCTATCACAGTATGCTGG + Intergenic
1051623013 9:19071545-19071567 ATTTTTCTTTTGTATTATGCAGG - Intronic
1051770880 9:20578036-20578058 TTTTCTGTTTAGTAGTATGTAGG - Intronic
1054875101 9:70087716-70087738 ATTTCTGGTTAACAGTATCCTGG - Intronic
1055455599 9:76468669-76468691 ATCTCTCTTTAGCAGAAAGATGG + Intronic
1057990676 9:99766424-99766446 ATTCCTCTTTTGCAGTATCATGG + Intergenic
1058667091 9:107329443-107329465 ATTTATCTTTAGTGCTATGCTGG + Intronic
1059072929 9:111158500-111158522 ATTTATCTTCAGCATTATTCAGG + Intergenic
1059559623 9:115320766-115320788 ATTTCTATTCAGCATTATACTGG + Intronic
1060122341 9:121005188-121005210 AATTCTCTTTAGGGGTGTGCTGG + Intronic
1061850990 9:133415386-133415408 ATTTCTGTGTAGCAGGATGTTGG - Intronic
1203694491 Un_GL000214v1:84061-84083 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
1203705064 Un_KI270742v1:33371-33393 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1203558945 Un_KI270744v1:32440-32462 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
1203641782 Un_KI270751v1:20002-20024 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1189162833 X:38828304-38828326 ATTTCTATTTAACATTGTGCTGG + Intergenic
1191768970 X:64733987-64734009 ATTTCTGGTTACCAGTATTCTGG - Intergenic
1192781822 X:74302044-74302066 ATTTCTATTCAGCATTGTGCTGG + Intergenic
1198167205 X:134069687-134069709 AGTTCTATTTAACACTATGCAGG + Intergenic
1198338452 X:135690832-135690854 ATTTCTCTTTGGCAAGAAGCAGG - Intergenic
1198424476 X:136502351-136502373 ATTTCTCATTTGCAGAATGAAGG - Intronic
1202391605 Y:24376138-24376160 ATTTCTATTTAACATTGTGCTGG + Intergenic
1202479180 Y:25293979-25294001 ATTTCTATTTAACATTGTGCTGG - Intergenic