ID: 1157662836

View in Genome Browser
Species Human (GRCh38)
Location 18:49460555-49460577
Sequence GCTGCAGGCCGGACCGGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 253}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157662836_1157662856 29 Left 1157662836 18:49460555-49460577 CCGGCTCCGGTCCGGCCTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 253
Right 1157662856 18:49460607-49460629 GCGTCGGTGCGGAGGCCAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 124
1157662836_1157662848 13 Left 1157662836 18:49460555-49460577 CCGGCTCCGGTCCGGCCTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 253
Right 1157662848 18:49460591-49460613 GGCTCCAGCCCGGGCCGCGTCGG 0: 1
1: 0
2: 3
3: 11
4: 177
1157662836_1157662842 -8 Left 1157662836 18:49460555-49460577 CCGGCTCCGGTCCGGCCTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 253
Right 1157662842 18:49460570-49460592 CCTGCAGCTCGGCCCCGGCTCGG 0: 1
1: 0
2: 0
3: 17
4: 201
1157662836_1157662845 4 Left 1157662836 18:49460555-49460577 CCGGCTCCGGTCCGGCCTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 253
Right 1157662845 18:49460582-49460604 CCCCGGCTCGGCTCCAGCCCGGG 0: 1
1: 0
2: 2
3: 54
4: 472
1157662836_1157662850 18 Left 1157662836 18:49460555-49460577 CCGGCTCCGGTCCGGCCTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 253
Right 1157662850 18:49460596-49460618 CAGCCCGGGCCGCGTCGGTGCGG 0: 1
1: 0
2: 0
3: 9
4: 115
1157662836_1157662852 21 Left 1157662836 18:49460555-49460577 CCGGCTCCGGTCCGGCCTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 253
Right 1157662852 18:49460599-49460621 CCCGGGCCGCGTCGGTGCGGAGG 0: 1
1: 0
2: 1
3: 18
4: 127
1157662836_1157662854 26 Left 1157662836 18:49460555-49460577 CCGGCTCCGGTCCGGCCTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 253
Right 1157662854 18:49460604-49460626 GCCGCGTCGGTGCGGAGGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
1157662836_1157662843 3 Left 1157662836 18:49460555-49460577 CCGGCTCCGGTCCGGCCTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 253
Right 1157662843 18:49460581-49460603 GCCCCGGCTCGGCTCCAGCCCGG 0: 1
1: 0
2: 2
3: 39
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157662836 Original CRISPR GCTGCAGGCCGGACCGGAGC CGG (reversed) Exonic
900386360 1:2412730-2412752 GGCGCAGGGCGGAGCGGAGCGGG + Intronic
900407510 1:2499015-2499037 GCTCCAGGCTGGAGCGGTGCTGG + Intronic
900586424 1:3434589-3434611 GCTGCAGGCCTGCCCGAGGCTGG + Exonic
901160812 1:7175588-7175610 GCTGCAGGCTGGGGAGGAGCAGG + Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
902624724 1:17669964-17669986 GCTGGACGCAGGACAGGAGCAGG + Intronic
902733564 1:18385460-18385482 GCTGCAGACCAGGCCAGAGCGGG + Intergenic
903022076 1:20401594-20401616 ACTGCAGGCAGGGCCGGGGCAGG - Intergenic
904237368 1:29123943-29123965 GCTGGAGGCGGGGCCGGGGCGGG - Intergenic
905889099 1:41508604-41508626 GCTGCAGGCTGGACTGTGGCTGG + Exonic
906254590 1:44338358-44338380 TCTGAAGGCCTGACCGGGGCTGG + Intronic
906517505 1:46448313-46448335 GCGGCAGGCGGGGCGGGAGCGGG - Intergenic
907464427 1:54625304-54625326 GCTGCTGGCTGGAATGGAGCAGG + Intronic
907675271 1:56512092-56512114 ACTGCAGGAGGGGCCGGAGCAGG + Exonic
913222094 1:116667760-116667782 GCGGCGGGCCGGGCTGGAGCTGG - Intergenic
913451128 1:118993316-118993338 AAGGCAGGCAGGACCGGAGCTGG - Intergenic
914847349 1:151290489-151290511 GCTGCAAGCCGTGCCGGACCTGG - Exonic
914997696 1:152559286-152559308 GCTGGAGACAGGACCTGAGCTGG - Intronic
915002150 1:152603346-152603368 GCTGGAGACAGGACCTGAGCTGG + Intergenic
915161381 1:153922863-153922885 GGGGCGGGCCGGACCGGGGCGGG + Exonic
919757037 1:201072724-201072746 GCTGGAGACTGGACTGGAGCAGG - Intronic
920048121 1:203146746-203146768 GCAGCAGGCCAGACCGGGCCTGG - Intronic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
922822336 1:228493211-228493233 GCTGCAGGCGGTCTCGGAGCTGG + Exonic
924624659 1:245688449-245688471 GCTGCGGGCCGGGCCCGAGGCGG + Exonic
1062907517 10:1188917-1188939 GCTGCTGGCCGCACTGGAGAAGG - Intronic
1062960014 10:1565876-1565898 GTTACAGGCAGGACCAGAGCAGG - Intronic
1063663164 10:8047585-8047607 GCTGCTGGGCTGACCCGAGCTGG + Intergenic
1068388102 10:56358818-56358840 GCAGCAGGCAGAACAGGAGCGGG - Exonic
1069607889 10:69751572-69751594 GCTGCAGGCAGGAAGGGAGAGGG + Intergenic
1069904640 10:71725140-71725162 GCTGCAGGCCTTCCCGGAGCAGG + Intronic
1070257614 10:74825481-74825503 GCTGCAGCCCGGAGCCGAGGAGG + Intergenic
1070597372 10:77841952-77841974 GCTGCAGACCGAAGTGGAGCTGG - Exonic
1071527351 10:86366282-86366304 GCTGGAGGCCGGGCCGAGGCTGG - Intronic
1074532257 10:114305686-114305708 GCTGCAGGAGGGAGCGGGGCTGG + Intronic
1075713367 10:124542539-124542561 GCTGCAGGCTGAACTGGAGCAGG - Intronic
1076156114 10:128206997-128207019 GCTGCTGGCCAGGCCTGAGCAGG + Intergenic
1077194445 11:1272291-1272313 GCTGCAGGCCGGGGCGCCGCGGG - Intergenic
1077479050 11:2804475-2804497 GATGGAGGCCGGAACAGAGCCGG + Intronic
1078699715 11:13668889-13668911 GCTGCAGGCCTGGCCGAGGCGGG + Intronic
1080878453 11:36297777-36297799 GCTGCAGGCCCCACTGGAGGAGG - Intronic
1082025068 11:47565640-47565662 GCTGGAGGCCGGCCTGGCGCGGG + Exonic
1083420465 11:62549673-62549695 CCTGCAGGCTGGAACAGAGCTGG + Intronic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083828699 11:65217553-65217575 GCTGCAGGTAGGACCAGACCAGG - Intergenic
1084146140 11:67266395-67266417 GCGGCAGGCGGGGCCGGAGGCGG + Exonic
1084178659 11:67436062-67436084 GCTGCAGGCCCGAGCTGAGCTGG - Exonic
1084779800 11:71400575-71400597 GCTGCAGGCTTGACTGGGGCTGG - Intergenic
1084789037 11:71461951-71461973 GCCGCAGCCAGGACCGGGGCAGG + Intronic
1089599219 11:119603219-119603241 GCTGGAGGCCGCCCAGGAGCGGG - Intergenic
1090029515 11:123195141-123195163 GCTGGCGCCCGGACGGGAGCCGG + Exonic
1090285585 11:125496274-125496296 GGTGGAGGCGGGAGCGGAGCCGG - Exonic
1091336277 11:134769116-134769138 CCTGCAGGCCAGAAGGGAGCAGG + Intergenic
1092365389 12:7872876-7872898 GCTGCAGGCGGGGCCGGCGGGGG - Intronic
1092487381 12:8914501-8914523 GCTGCGGGCCGGGCTGGAGGAGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1094536564 12:31326436-31326458 GCTGCAGGCCGCGGCGGAGAGGG + Intronic
1096796730 12:54082554-54082576 GCGGCGGGCCGGTCCGGGGCCGG + Intergenic
1096981216 12:55729021-55729043 GCGGCAGGCGGGGCGGGAGCCGG - Intronic
1097537386 12:60889335-60889357 GCTGCAGGCTGCATGGGAGCTGG - Intergenic
1102034146 12:109761362-109761384 GCTCCAGGCAGGACCCGAGGAGG + Intronic
1102111851 12:110371077-110371099 GCTGCAGGCCTGACCCCAGAGGG - Intergenic
1103323163 12:120103241-120103263 GCTGCAGGCCGGGGGGAAGCTGG - Intronic
1104756130 12:131270405-131270427 CCTGCAGGCAGTCCCGGAGCGGG + Intergenic
1104777647 12:131400620-131400642 CCTGCAGGCAGTCCCGGAGCTGG - Intergenic
1106602680 13:31200612-31200634 GCGGGAGGCTGGACGGGAGCCGG + Intronic
1113927868 13:113951341-113951363 CCTGCGGGCCGGGCTGGAGCCGG + Intergenic
1114863777 14:26561214-26561236 GCCACAGACCGGACCAGAGCAGG + Intronic
1117309826 14:54510124-54510146 GCAGCAGGGGGCACCGGAGCCGG + Intronic
1120996035 14:90419472-90419494 CCTGCAGGCCCGCCTGGAGCAGG - Intergenic
1121691034 14:95877105-95877127 GCCGCAGCCCGGCCCGGACCCGG - Intergenic
1122347368 14:101068843-101068865 GCTGCATGCCGGGCCGACGCCGG - Intergenic
1123219805 14:106844808-106844830 GCTGCAGGAGGGGCCGGTGCGGG - Intergenic
1123458458 15:20446487-20446509 GCTGCAGGCTGGCCCTCAGCTGG + Intergenic
1123659605 15:22553922-22553944 GCTGCAGGCTGGCCCTCAGCTGG - Intergenic
1124313468 15:28648417-28648439 GCTGCAGGCTGGCCCTCAGCTGG - Intergenic
1124696724 15:31870236-31870258 GCGCCACGCCGGGCCGGAGCCGG + Intronic
1126849638 15:52789315-52789337 GATGCTGCCCAGACCGGAGCTGG + Exonic
1127871633 15:63079028-63079050 GCTGGAGTCCAGGCCGGAGCAGG - Intergenic
1128153661 15:65378229-65378251 GCTGCAGCCCGGGACGGCGCCGG - Intergenic
1129152563 15:73698120-73698142 GCTGCAGGTCAGGCCTGAGCTGG - Intronic
1129169221 15:73797734-73797756 GCTGCAGGACTGGCAGGAGCGGG + Intergenic
1130128785 15:81118461-81118483 GCTGCTTGTGGGACCGGAGCGGG + Intronic
1131272809 15:90957201-90957223 GCTGCGCGCCGGGCCGGGGCCGG + Exonic
1131588400 15:93720943-93720965 GCTGCTGCCCGGAGCTGAGCTGG - Intergenic
1132494229 16:253210-253232 CCTGCTGGCCGGACCGGGGGTGG - Intronic
1132641920 16:981942-981964 GCTGCAGGGCGGCTGGGAGCGGG - Exonic
1132669797 16:1097915-1097937 GCTGCAGGCCAGGCCTGAGTGGG + Intergenic
1132889711 16:2197489-2197511 GCTGCAGGCCTGACGGGAGAGGG - Intergenic
1132915226 16:2340441-2340463 CCCGCAGGCCAGGCCGGAGCTGG + Intronic
1133058471 16:3159120-3159142 GCCGCAAGCCGGACGGAAGCGGG - Intergenic
1133231889 16:4370855-4370877 GCTACAGGCCGGGCTGGAGGGGG + Intronic
1133306357 16:4812055-4812077 GCTCCAGGCCTGACAGGTGCAGG + Intronic
1135269595 16:21057667-21057689 GCTGAAGGCAGGACGGGAGGTGG + Intronic
1136226519 16:28863939-28863961 GATGCAGGTGGGACCGGAACCGG + Intronic
1136318277 16:29466580-29466602 GCTGGAGGCGGGACCTGAGGTGG + Exonic
1136432852 16:30205929-30205951 GCTGGAGGCGGGACCTGAGGTGG + Exonic
1137731470 16:50693585-50693607 GCCGCAGCCCGAGCCGGAGCCGG + Intronic
1139471048 16:67178424-67178446 GCCGCAGCCCGTACCGCAGCCGG + Exonic
1141469631 16:84229609-84229631 CCTGCAGGCCGGGCCTGTGCTGG - Intronic
1141952683 16:87348784-87348806 GCAGCAGGCAGGACCAGCGCAGG + Intronic
1142131884 16:88434915-88434937 GCTCCGGGCCGGGCCTGAGCCGG + Exonic
1142355620 16:89600268-89600290 GGAGCAGGCCTGACAGGAGCAGG - Intergenic
1142590204 17:1001381-1001403 GCTTCAGGCCTGACCACAGCTGG + Exonic
1143067792 17:4263659-4263681 GCTGCACGCAGCACCGGCGCGGG + Exonic
1144964909 17:19070725-19070747 GCCGCAGACCGGCCAGGAGCAGG + Intergenic
1144983058 17:19181453-19181475 GCCGCAGACCGGCCAGGAGCAGG - Intergenic
1144985166 17:19196786-19196808 GCCGCAGACCGGCCAGGAGCAGG + Intergenic
1145098622 17:20054307-20054329 GCTGCAGGAGAGACAGGAGCTGG - Intronic
1147978076 17:44259279-44259301 GCTGCAGGAGGCAGCGGAGCTGG - Exonic
1148092724 17:45032331-45032353 GCTCCAGCCCGGACGGGAGGGGG + Intronic
1148792043 17:50178591-50178613 GCTGCACGCTGCCCCGGAGCAGG + Intergenic
1148930078 17:51120757-51120779 GCTGGAGCCCGGGCCGGGGCTGG + Exonic
1149376424 17:56048574-56048596 GCTGCAGGCCTGTCCTGAGGAGG - Intergenic
1151184644 17:72354420-72354442 GCAGCAGGCAGGACCTGGGCTGG + Intergenic
1151486165 17:74402138-74402160 GATGCAGGGAGGGCCGGAGCAGG - Intergenic
1151900213 17:77007436-77007458 CCTGCAGGCCGGACCCCTGCCGG + Intergenic
1152133781 17:78492378-78492400 ACTGCAGGCCTGCCCCGAGCAGG - Intronic
1152552150 17:81035218-81035240 GCTGCACCACAGACCGGAGCGGG - Exonic
1152586236 17:81190661-81190683 GCTGCAGGCCCGCCAGCAGCTGG - Exonic
1152914896 17:83029059-83029081 GCTGCCGTGGGGACCGGAGCCGG + Intronic
1152928775 17:83099701-83099723 GCTGCAGGCCAGACACCAGCAGG - Intergenic
1153815135 18:8784687-8784709 GCTGCAGGCCTTCCTGGAGCAGG + Exonic
1154204407 18:12325060-12325082 GTTGCAGGCCAGACGGGTGCAGG + Exonic
1157121492 18:44915645-44915667 GTTCCAGGCAGGACCAGAGCAGG + Intronic
1157662836 18:49460555-49460577 GCTGCAGGCCGGACCGGAGCCGG - Exonic
1157710602 18:49847331-49847353 GCTGCAGGCCTGAGGGTAGCGGG + Intronic
1160706241 19:531577-531599 GCCGTAGGCGGGACCGGGGCCGG + Intergenic
1160740408 19:682972-682994 TCTGCAGGCCTGGCCGGGGCAGG - Exonic
1160919412 19:1512866-1512888 GCTGCAGCCCGGACTGGCGGAGG + Intronic
1160993472 19:1871294-1871316 CCTGCAGGCCTGTCCGGAGGTGG - Intergenic
1161026815 19:2040755-2040777 GCAGCAGGCTGGAGCGAAGCGGG - Intronic
1161426737 19:4207835-4207857 GCTGCAGGGCGGAGCCCAGCCGG + Exonic
1161479665 19:4504251-4504273 GATGCAGGCAGGCCCGGAGCAGG + Exonic
1162158956 19:8697879-8697901 GGAGCAGGCCCGGCCGGAGCAGG - Exonic
1162328047 19:10010319-10010341 GCTGCAGCGCGGCCAGGAGCAGG + Exonic
1163517937 19:17776066-17776088 GCTGGAGCCCGGGCCGGGGCAGG - Exonic
1164051308 19:21587231-21587253 CCTGCTGTCCGGACAGGAGCGGG + Intergenic
1165058718 19:33194719-33194741 GCCGCAGCCGGAACCGGAGCCGG + Exonic
1165065788 19:33227009-33227031 GCTGCAGGGTGGACCGGGGTGGG + Intergenic
1166053432 19:40274709-40274731 GCTGCAGGCAGGGGAGGAGCAGG + Intronic
1167114273 19:47479973-47479995 GCTGCGGGCGGGACCGGGGTGGG - Intronic
1167232967 19:48297018-48297040 GCTGGAGGCAGGGCCGGTGCTGG + Exonic
1167430807 19:49453379-49453401 GCTGGAGTACGGACCGGTGCCGG + Exonic
925200964 2:1967666-1967688 ACTTCAGGCCTGACTGGAGCTGG + Intronic
926008094 2:9388474-9388496 GCTGCAGGCTGGGCGGGAGGTGG - Exonic
927482785 2:23467740-23467762 GCTGCAGGCGGGATGGGAACAGG + Intronic
927706639 2:25300228-25300250 CCTGCAGGACGGAGAGGAGCAGG - Exonic
928983183 2:37156820-37156842 GCTGCAGGCCCAGCCGGGGCGGG - Intronic
929948719 2:46389815-46389837 GGGGCAGGCAGGACGGGAGCTGG + Intergenic
931228019 2:60350951-60350973 GCTCCAGGCAGGACTGGAGAAGG - Intergenic
932599360 2:73113064-73113086 GCCGCAGACCAGCCCGGAGCGGG + Intronic
934717774 2:96553300-96553322 CCTGCAGGCCGGATGGGAGCAGG + Intergenic
935971524 2:108534453-108534475 GCTACTGGCGGGCCCGGAGCAGG - Intronic
937127284 2:119482681-119482703 GCTGCTGGCTGGGCCTGAGCAGG + Intronic
937261152 2:120587420-120587442 GCCGCGGGCCGGGCCGGGGCAGG - Intergenic
937955085 2:127417576-127417598 GGTGCAGCCCGGTTCGGAGCAGG + Intergenic
940774932 2:157875856-157875878 GCTGCAGGTCGGCGCGGCGCGGG + Intronic
942267413 2:174242370-174242392 GCTGCTGACCTGACCGGAGGTGG + Intronic
947524580 2:230870424-230870446 TCTGCAGGCTGGAGCGGAGCTGG + Intronic
947866684 2:233402636-233402658 GCTGCCGGCCGGACATGAGCTGG - Intronic
948207091 2:236168127-236168149 GCTGCATGCCGGGCGGGTGCAGG + Exonic
948542817 2:238702443-238702465 GCTGCAGGCCGGAGAAGAGGAGG + Intergenic
1169123454 20:3110964-3110986 GCTGCAGGGCTGAAGGGAGCAGG - Intronic
1169262452 20:4148772-4148794 GCGGAGGGCCGGGCCGGAGCGGG + Exonic
1170698675 20:18683856-18683878 GCTGCAGGCAGAAAGGGAGCAGG - Intronic
1170999187 20:21396567-21396589 GCTCCAGGCCCGCCGGGAGCCGG + Intronic
1172113071 20:32558889-32558911 ACTGCAGCCTGGACCGGAGCAGG + Intronic
1172116573 20:32576738-32576760 GCTGCAGGCCTGGCCTGGGCGGG - Intronic
1172838305 20:37886913-37886935 GCTGCAGGCTGGGCCGGGGAAGG + Intergenic
1172962161 20:38806716-38806738 GCTGGAGGCCGGGCCGGGGTGGG - Intronic
1174100168 20:48121266-48121288 GCTGGAGGCCGAAGAGGAGCTGG - Intergenic
1174153126 20:48500142-48500164 GCTGGAGGCCGAAGAGGAGCTGG - Intergenic
1174287630 20:49483819-49483841 GCTCCAGGCTGGAGGGGAGCGGG - Intergenic
1175975690 20:62709270-62709292 GGCGCAGGCCGGACTGGAGGAGG + Exonic
1176031710 20:63016047-63016069 GCTGCAGGCCTGGGCGGGGCGGG - Intergenic
1176099794 20:63359728-63359750 GGTGCAGGCGGGACAGGAGCCGG + Intronic
1176247375 20:64103920-64103942 GCTGCAGGCCTGAGCCGAGTGGG + Intergenic
1176299401 21:5091422-5091444 GCTACGGGACGGAGCGGAGCGGG - Intergenic
1179718446 21:43302112-43302134 CCTGCAGCCCGGAGCTGAGCTGG - Intergenic
1179857625 21:44170525-44170547 GCTACGGGACGGAGCGGAGCGGG + Intergenic
1179903265 21:44406055-44406077 GCTGCAGGCCGCGATGGAGCCGG - Intronic
1182422630 22:30256037-30256059 GCTGCAGGCTGGCCTGGGGCTGG - Intergenic
1183401719 22:37608920-37608942 GGCGCGGGCCGGACCGGAACCGG + Intronic
1183455788 22:37922359-37922381 GCTGCAGACTGGAGCGGGGCCGG - Exonic
1184659464 22:45959227-45959249 GCTGCAGGCTGGACAGGGGGTGG + Intronic
1185384418 22:50525335-50525357 GCTGGAGGCCGGAGCGAGGCTGG - Intronic
953170604 3:40503538-40503560 GCTGGAGGCAGGAGAGGAGCAGG - Intergenic
953614480 3:44477750-44477772 GCCGCCCGCCGCACCGGAGCCGG - Intergenic
953715054 3:45310376-45310398 GCTGGAGGCAGGAGAGGAGCAGG + Intergenic
954318305 3:49813230-49813252 GCTGCAGGCCTGAGCTGACCTGG + Exonic
960440023 3:117675322-117675344 GCTCTAGGCCCGACCAGAGCAGG - Intergenic
968468398 4:764637-764659 GCTGCAGGCCAGATAGGGGCGGG + Intronic
968550657 4:1222133-1222155 GCTCCAGGCGGGGCCGGTGCTGG - Intronic
968583405 4:1405134-1405156 GCTGCGGGCCGCACCTGCGCGGG - Intronic
968828145 4:2914792-2914814 GCTGCAGGCAGGGCGGGGGCAGG - Intronic
968899038 4:3422242-3422264 GCTGCAGGTGGGACCGTGGCAGG + Intronic
975243818 4:72094630-72094652 GCTGCAGGCTGCATAGGAGCTGG - Intronic
978126961 4:105146605-105146627 GGCGCAGGCCGGGGCGGAGCGGG + Exonic
978503463 4:109433547-109433569 CCTGCAGGCCGGAGCCGAGCTGG - Intergenic
985251789 4:188031796-188031818 GCTGCAGGACTGAGCTGAGCAGG + Intergenic
998183080 5:139959026-139959048 GCTGCAGGGCAGACTGGGGCAGG + Intronic
999431954 5:151532010-151532032 GCTGCAGGCAGGTCCAGAGGAGG - Intronic
1001416091 5:171545625-171545647 GAAGCAGGCCGGACCAGGGCAGG - Intergenic
1002139950 5:177132642-177132664 GCTGCAGCCCGGCTCGGTGCCGG + Intergenic
1002591064 5:180291955-180291977 GCGGCGGGGCGGAGCGGAGCGGG - Exonic
1002600727 5:180352904-180352926 GGTCCAGGCCGGACCGGACCAGG + Intronic
1002757818 6:178479-178501 GCTGCAGGGCGGATAGCAGCCGG + Intergenic
1002789809 6:428673-428695 CCTGCAGGCCTGACAGGAGAGGG + Intergenic
1003116404 6:3286633-3286655 GGTGCAGCCCGGGCCGGGGCAGG + Intronic
1003565369 6:7217564-7217586 GCGGCAGGCTGGGACGGAGCCGG - Intronic
1004396154 6:15248240-15248262 GCGGCAGGCTGGGCCGGGGCTGG + Intronic
1006514286 6:34537505-34537527 GCTACATGCAGGACCGGAGTGGG - Intergenic
1006634577 6:35452641-35452663 GCTGCAGGCGGGGCCTGAGGGGG + Exonic
1006787869 6:36679961-36679983 GCTACAGGGCTGAGCGGAGCAGG + Intronic
1006910367 6:37559452-37559474 GCTGCAGGCAGAGCTGGAGCTGG + Intergenic
1013287544 6:108693979-108694001 GCTGCAGGCTGGCCCAGAGCTGG - Intergenic
1015732856 6:136365914-136365936 GATGGGGGCCGGACCTGAGCAGG + Exonic
1016936219 6:149451036-149451058 GCTGCAGGCCGGGCGGAGGCGGG + Exonic
1017009917 6:150056425-150056447 TCTGCAGGCTGGAACTGAGCAGG - Intergenic
1017081357 6:150672054-150672076 GCTGCAGGCCAGTCAAGAGCTGG + Intronic
1018596708 6:165488766-165488788 GCTGCAGGCTCCACGGGAGCTGG + Intronic
1019101931 6:169638611-169638633 GCTGGAGCCAGGACCGGAGGTGG - Exonic
1019112003 6:169724187-169724209 GCTGCGGGCCGGAATGGAGGAGG + Intronic
1019403239 7:868409-868431 GCTGCAGGCTGCACCGTGGCCGG + Intronic
1021793288 7:24227831-24227853 GCTGCAGGCAGGCACAGAGCTGG - Intergenic
1024082639 7:45867717-45867739 GCTGCAAGCCAGTCCTGAGCAGG - Intergenic
1025790711 7:64684614-64684636 GAAGCAGGGCGGACAGGAGCAGG - Intronic
1026308347 7:69162021-69162043 GCTGCAGCCTGGACCATAGCTGG + Intergenic
1028905884 7:96153565-96153587 GCTGCAGGCAGCACCACAGCGGG + Intronic
1029628252 7:101733978-101734000 TCTGCCGGCCGGGCCGGCGCAGG + Intergenic
1029705567 7:102274089-102274111 GCTGCAGGAGGGCCCGGACCTGG - Intronic
1032736687 7:134698864-134698886 GCTGAAGGCTGGACGGGAGAGGG - Intergenic
1033421680 7:141209675-141209697 GCTGCAGGAAGGACAGAAGCAGG + Intronic
1034429610 7:151034591-151034613 GCGGCTGGCAGTACCGGAGCAGG - Exonic
1034475130 7:151277155-151277177 GCTGCAGCCCGGAGCGGGGGAGG + Intronic
1035063887 7:156091479-156091501 GCCGCAGGCTGGAGTGGAGCAGG + Intergenic
1035731482 8:1856656-1856678 GCTGCAGGCAGCTCCGGAGGGGG - Intronic
1036032743 8:4991798-4991820 GCTGCAGGCAGGAAGGGGGCTGG - Intronic
1037807406 8:22066411-22066433 GCCGCAGGCCGGGCCGGGGCGGG + Intronic
1037814272 8:22103587-22103609 GCTGCAGCCAGGAGGGGAGCGGG + Exonic
1038540437 8:28386131-28386153 GCGGGCGGCCGGAGCGGAGCCGG - Intronic
1041051566 8:53939645-53939667 GCCCCAGGCCAGCCCGGAGCGGG + Exonic
1042928466 8:73990507-73990529 GCTGCTGGTCTGACAGGAGCTGG - Intergenic
1045547362 8:103140762-103140784 GCTGCAGCGCGGGCGGGAGCGGG + Exonic
1048666395 8:136666124-136666146 GCTGAAGGCTTGACTGGAGCTGG + Intergenic
1048816570 8:138339926-138339948 ACTGCAGGCTGGACCGGATGGGG - Intronic
1049240440 8:141535139-141535161 GATGGAGGGAGGACCGGAGCTGG + Intergenic
1049657114 8:143803808-143803830 GCTCCAGGCAGGGCCGGAGCAGG + Exonic
1049682276 8:143924756-143924778 GCTGCGGGCCGAGACGGAGCAGG - Exonic
1049747765 8:144270222-144270244 GCAGGAGGCCAGACAGGAGCAGG + Intronic
1049761192 8:144332707-144332729 GCAGCAGGCCGGGGCGGAGCAGG - Exonic
1052888936 9:33677364-33677386 GCTTCAGGCCGGGCCGGGCCGGG + Intergenic
1053346389 9:37381576-37381598 TCTGCAGCCCGGACAGGAGCTGG - Intergenic
1053786328 9:41655219-41655241 GCGGCAGGCCGGTCCTGGGCCGG + Intergenic
1056172146 9:83996750-83996772 TCTGCAGGCTGTACAGGAGCAGG + Intronic
1059437102 9:114283611-114283633 GCTGCTGGGCGGAGCGGGGCTGG + Intronic
1060494078 9:124105256-124105278 GATGAAGGCCTGACCGGGGCAGG - Intergenic
1060596759 9:124853307-124853329 GCAGCAGGCGGGACCGCGGCGGG - Intergenic
1061213811 9:129208743-129208765 GAGGCAGGCCGGACAGGAGAAGG - Intergenic
1061235020 9:129337136-129337158 GCTGGAGGCAGGAGGGGAGCCGG + Intergenic
1061927794 9:133814621-133814643 GCTGCAAGCCGGACCTGGACAGG + Intronic
1062151902 9:135023981-135024003 GCTGCAGGCTGCACGGGGGCGGG + Intergenic
1062206508 9:135340537-135340559 GCTGCGGGCCGGGCCGGGCCTGG - Intergenic
1062333405 9:136054409-136054431 GCTGAGAGCCGGACAGGAGCTGG + Intronic
1062472494 9:136712592-136712614 GCTGCGGGCCGGGCCGGGCCGGG + Exonic
1062566029 9:137164358-137164380 GCACCAGGCAGGACCGGACCTGG - Intronic
1188440603 X:30212225-30212247 GCTGCATGCTGGACTGGAGGAGG + Intergenic
1190385553 X:49879713-49879735 GCTGGAGCCCGAACCCGAGCCGG + Intergenic
1193937092 X:87636661-87636683 GCTGCAGGCTGCATGGGAGCTGG + Intronic
1195237065 X:102911165-102911187 GCTGCAGGCTGCATGGGAGCAGG + Intergenic
1199676142 X:150190809-150190831 GCTGCAGGCCTGACAGGTCCTGG + Intergenic