ID: 1157663143

View in Genome Browser
Species Human (GRCh38)
Location 18:49463244-49463266
Sequence AACTGCCTGCAGAAGTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157663141_1157663143 -3 Left 1157663141 18:49463224-49463246 CCTTGGACACCAACTTTCAAAAC No data
Right 1157663143 18:49463244-49463266 AACTGCCTGCAGAAGTATGATGG No data
1157663139_1157663143 30 Left 1157663139 18:49463191-49463213 CCTTTTTTGTACATGTAATGTGC No data
Right 1157663143 18:49463244-49463266 AACTGCCTGCAGAAGTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157663143 Original CRISPR AACTGCCTGCAGAAGTATGA TGG Intergenic
No off target data available for this crispr