ID: 1157665488

View in Genome Browser
Species Human (GRCh38)
Location 18:49483131-49483153
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157665488_1157665491 -9 Left 1157665488 18:49483131-49483153 CCAGAGTGAAAACATTTTGCTTC No data
Right 1157665491 18:49483145-49483167 TTTTGCTTCCAGAAACGGGCCGG No data
1157665488_1157665492 -5 Left 1157665488 18:49483131-49483153 CCAGAGTGAAAACATTTTGCTTC No data
Right 1157665492 18:49483149-49483171 GCTTCCAGAAACGGGCCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157665488 Original CRISPR GAAGCAAAATGTTTTCACTC TGG (reversed) Intronic