ID: 1157665488 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:49483131-49483153 |
| Sequence | GAAGCAAAATGTTTTCACTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1157665488_1157665491 | -9 | Left | 1157665488 | 18:49483131-49483153 | CCAGAGTGAAAACATTTTGCTTC | No data | ||
| Right | 1157665491 | 18:49483145-49483167 | TTTTGCTTCCAGAAACGGGCCGG | No data | ||||
| 1157665488_1157665492 | -5 | Left | 1157665488 | 18:49483131-49483153 | CCAGAGTGAAAACATTTTGCTTC | No data | ||
| Right | 1157665492 | 18:49483149-49483171 | GCTTCCAGAAACGGGCCGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1157665488 | Original CRISPR | GAAGCAAAATGTTTTCACTC TGG (reversed) | Intronic | ||