ID: 1157665491

View in Genome Browser
Species Human (GRCh38)
Location 18:49483145-49483167
Sequence TTTTGCTTCCAGAAACGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157665486_1157665491 30 Left 1157665486 18:49483092-49483114 CCCAGCTCAAGAAACATTCTCTT No data
Right 1157665491 18:49483145-49483167 TTTTGCTTCCAGAAACGGGCCGG No data
1157665487_1157665491 29 Left 1157665487 18:49483093-49483115 CCAGCTCAAGAAACATTCTCTTT No data
Right 1157665491 18:49483145-49483167 TTTTGCTTCCAGAAACGGGCCGG No data
1157665488_1157665491 -9 Left 1157665488 18:49483131-49483153 CCAGAGTGAAAACATTTTGCTTC No data
Right 1157665491 18:49483145-49483167 TTTTGCTTCCAGAAACGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157665491 Original CRISPR TTTTGCTTCCAGAAACGGGC CGG Intronic