ID: 1157666639

View in Genome Browser
Species Human (GRCh38)
Location 18:49492921-49492943
Sequence GTGAAAAATGCGCTAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157666637_1157666639 1 Left 1157666637 18:49492897-49492919 CCAATCAATTGTATTATAACCTG No data
Right 1157666639 18:49492921-49492943 GTGAAAAATGCGCTAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157666639 Original CRISPR GTGAAAAATGCGCTAACTGA AGG Intergenic
No off target data available for this crispr