ID: 1157668754

View in Genome Browser
Species Human (GRCh38)
Location 18:49510898-49510920
Sequence CACCCTGGGGAGCAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157668754_1157668763 15 Left 1157668754 18:49510898-49510920 CCCTGTCCCTGCTCCCCAGGGTG No data
Right 1157668763 18:49510936-49510958 TACCAGCAGGTGAATGCCGCAGG No data
1157668754_1157668762 2 Left 1157668754 18:49510898-49510920 CCCTGTCCCTGCTCCCCAGGGTG No data
Right 1157668762 18:49510923-49510945 ACAAGAGAATGAGTACCAGCAGG No data
1157668754_1157668764 16 Left 1157668754 18:49510898-49510920 CCCTGTCCCTGCTCCCCAGGGTG No data
Right 1157668764 18:49510937-49510959 ACCAGCAGGTGAATGCCGCAGGG No data
1157668754_1157668767 26 Left 1157668754 18:49510898-49510920 CCCTGTCCCTGCTCCCCAGGGTG No data
Right 1157668767 18:49510947-49510969 GAATGCCGCAGGGGCCATCTTGG No data
1157668754_1157668766 17 Left 1157668754 18:49510898-49510920 CCCTGTCCCTGCTCCCCAGGGTG No data
Right 1157668766 18:49510938-49510960 CCAGCAGGTGAATGCCGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157668754 Original CRISPR CACCCTGGGGAGCAGGGACA GGG (reversed) Intergenic
No off target data available for this crispr