ID: 1157669721

View in Genome Browser
Species Human (GRCh38)
Location 18:49518114-49518136
Sequence GGTACCGTGGCTCACCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157669713_1157669721 30 Left 1157669713 18:49518061-49518083 CCCCAAAAATACTTTCGAAGAAA No data
Right 1157669721 18:49518114-49518136 GGTACCGTGGCTCACCAAGTTGG No data
1157669714_1157669721 29 Left 1157669714 18:49518062-49518084 CCCAAAAATACTTTCGAAGAAAC No data
Right 1157669721 18:49518114-49518136 GGTACCGTGGCTCACCAAGTTGG No data
1157669715_1157669721 28 Left 1157669715 18:49518063-49518085 CCAAAAATACTTTCGAAGAAACA No data
Right 1157669721 18:49518114-49518136 GGTACCGTGGCTCACCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157669721 Original CRISPR GGTACCGTGGCTCACCAAGT TGG Intergenic
No off target data available for this crispr