ID: 1157678420

View in Genome Browser
Species Human (GRCh38)
Location 18:49584575-49584597
Sequence ATGGAGAAAATGCCAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 531}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157678420_1157678427 28 Left 1157678420 18:49584575-49584597 CCCTCCTCTGGCATTTTCTCCAT 0: 1
1: 0
2: 4
3: 54
4: 531
Right 1157678427 18:49584626-49584648 TCGTCATCTATGACACAGCTTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1157678420_1157678424 -2 Left 1157678420 18:49584575-49584597 CCCTCCTCTGGCATTTTCTCCAT 0: 1
1: 0
2: 4
3: 54
4: 531
Right 1157678424 18:49584596-49584618 ATTATAATTCCTGCCATGTCTGG 0: 1
1: 0
2: 3
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157678420 Original CRISPR ATGGAGAAAATGCCAGAGGA GGG (reversed) Intronic
900001767 1:18385-18407 ATGGAGAAGATCACAGAGGCTGG + Intergenic
900021487 1:188908-188930 ATGGAGAAGATCACAGAGGCTGG + Intergenic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
901502181 1:9659478-9659500 ATGAAAAAAATGCCTGAGGGTGG - Intronic
901923704 1:12553022-12553044 AGGGAGAAGGTGCCAGAGCAGGG - Intergenic
901972034 1:12915667-12915689 CTGGGGCAGATGCCAGAGGAAGG - Intronic
902013145 1:13286095-13286117 CTGGGGCAGATGCCAGAGGAAGG + Intergenic
902714900 1:18265885-18265907 CTGGAGAAAATGCCAGTGGAAGG - Intronic
904037416 1:27566325-27566347 AGGGCGACCATGCCAGAGGAAGG + Intronic
904347463 1:29882540-29882562 ATGGAGAAGAAACCAGAGCAGGG + Intergenic
904469929 1:30729933-30729955 AGGTAGAAATTCCCAGAGGAAGG + Intergenic
904964749 1:34362983-34363005 ATGGAGAGAAGCCCAGAGGCAGG + Intergenic
905560027 1:38919112-38919134 GAGGAGAAAATGAGAGAGGATGG - Exonic
907620634 1:55974681-55974703 TTTGAGAAAAATCCAGAGGATGG + Intergenic
908481214 1:64541480-64541502 ATGGAGAAATTGCCATTGGTAGG + Intronic
908784679 1:67723233-67723255 ATGAAGAAAAGTGCAGAGGATGG + Intronic
908858460 1:68455589-68455611 AAGGGGAAAATGGCAGATGATGG - Intergenic
909102524 1:71367327-71367349 ATGGAGAAAATGACAGCAGCAGG - Intergenic
909130136 1:71724756-71724778 ATGAAGCAAATACCAGAGGCTGG - Intronic
909276221 1:73690278-73690300 TGGGAGAAACTTCCAGAGGAAGG - Intergenic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
910204414 1:84733657-84733679 GTCCAGAAAATGCAAGAGGAAGG - Intergenic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
911105034 1:94122975-94122997 GAGGAGGGAATGCCAGAGGAAGG + Intergenic
911148994 1:94579498-94579520 ATGGAGGACCTTCCAGAGGAAGG - Intergenic
911718690 1:101166202-101166224 ATAGAGAAGAGGCCAGAGGATGG - Intergenic
911763227 1:101640683-101640705 TTGGAGAACATACCTGAGGATGG + Intergenic
912118203 1:106434354-106434376 ATGCAGAATATTACAGAGGATGG + Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
913690937 1:121279231-121279253 AAGGAGAAAATGGGGGAGGAAGG - Intronic
913960574 1:143335705-143335727 ATGGAAAGAGTGCCAGAGAATGG + Intergenic
914054928 1:144161277-144161299 ATGGAAAGAGTGCCAGAGAATGG + Intergenic
914124218 1:144805084-144805106 ATGGAAAGAGTGCCAGAGAATGG - Intergenic
914146603 1:145000732-145000754 AAGGAGAAAATGGGGGAGGAAGG + Intronic
914915468 1:151816545-151816567 ATGGAGAGGAGACCAGAGGATGG + Intronic
915061910 1:153193149-153193171 CTGGATAAACTGCCACAGGATGG + Intergenic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
917686328 1:177419766-177419788 AAGGAGAACAGGGCAGAGGAGGG - Intergenic
918319836 1:183353910-183353932 ATGGAGCCAATTCCAGAGTAGGG - Intronic
918786496 1:188769989-188770011 ATGGAGAAATTGACAGAAGCAGG + Intergenic
919052615 1:192529969-192529991 AAGGGGAAAATTCCAGAGGGAGG + Intergenic
920320726 1:205120382-205120404 ATAAAGAGAATGCCAGGGGATGG - Intronic
920369041 1:205465983-205466005 ATGGACAAAATGTCAGACTAAGG - Intergenic
920478259 1:206297706-206297728 AAGGAGAAAATGGGGGAGGAAGG - Intronic
921007084 1:211104604-211104626 ACTAACAAAATGCCAGAGGAGGG + Intronic
921101853 1:211935356-211935378 AAGAAGAAAATGCCAAACGATGG + Intergenic
921164772 1:212499098-212499120 ATGGAGAAAAATCAAAAGGAGGG + Intergenic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
921755252 1:218847834-218847856 ATAGGACAAATGCCAGAGGAAGG + Intergenic
922666453 1:227473731-227473753 ATGGAGAGCAAGCCAAAGGAGGG + Intergenic
922988134 1:229882633-229882655 GTGGAGAGCATGCCAGAGGAGGG - Intergenic
923260659 1:232264736-232264758 ATGGAAAAAGACCCAGAGGAAGG - Intergenic
923863188 1:237913162-237913184 GTGGGGAAAATGGCAGAGCAAGG - Intergenic
924294788 1:242575447-242575469 ATGGAGCAAATCACAGAGCAAGG + Intergenic
1063659277 10:8022465-8022487 ATGGAGAAAAGGCCAGGGGTAGG + Intergenic
1063877859 10:10498639-10498661 ATGGGGAAGAGGCTAGAGGAAGG - Intergenic
1065270988 10:24033824-24033846 ATAGACAAAATGCCAGTGAATGG - Intronic
1067029003 10:42867961-42867983 ATGGAGAGAGTGCCAGAGAATGG + Intergenic
1067554304 10:47257470-47257492 ATGGTGGAGATGCCAGAGGAGGG + Intergenic
1068856415 10:61802420-61802442 TTGGAGTCAATGTCAGAGGAAGG + Intergenic
1069712600 10:70499619-70499641 AGGGAGAAAATGCCAGGCCACGG - Intronic
1070574845 10:77670277-77670299 AGGGAGAGAATGAGAGAGGAAGG + Intergenic
1070574852 10:77670307-77670329 AGGGAGAGAATGAGAGAGGAAGG + Intergenic
1070574859 10:77670333-77670355 AGGGAGAGAATGAGAGAGGAAGG + Intergenic
1070574877 10:77670398-77670420 AGGGAGAGAATGAGAGAGGAAGG + Intergenic
1070574903 10:77670502-77670524 AGGGAGAGAATGAGAGAGGAAGG + Intergenic
1070574919 10:77670567-77670589 AGGGAGAGAATGAGAGAGGAAGG + Intergenic
1070574927 10:77670601-77670623 AGGGAGAGAATGAGAGAGGAAGG + Intergenic
1071879067 10:89874971-89874993 TTGGAGAAATAGCCACAGGATGG + Intergenic
1072351107 10:94558368-94558390 ATGGAGAAAGAGCCAAAGTATGG + Intronic
1072838530 10:98743627-98743649 ATGGGGAAAATGCCACAAAATGG - Intronic
1073561350 10:104499392-104499414 AGGGAAAAGATGTCAGAGGAAGG + Intergenic
1074222412 10:111450992-111451014 AGGGAGAACATGCCAAGGGAGGG - Intergenic
1074296321 10:112192656-112192678 AGTGGGAAAATGGCAGAGGAAGG + Intronic
1074543667 10:114386150-114386172 ATGGAGAAAATGCCTATGGTAGG + Intronic
1076590782 10:131580689-131580711 AAGCAGAAAATGTCAGAGCAAGG + Intergenic
1078691369 11:13583458-13583480 ATGGACAAAATGACAGAAGTAGG + Intergenic
1078867748 11:15313508-15313530 AGGGAGAAAAAGACAGAGAAGGG - Intergenic
1078912527 11:15746337-15746359 ATAAAGAAAATCCTAGAGGAAGG + Intergenic
1079869217 11:25775428-25775450 ATTGAGAAAATGCCACTTGAGGG - Intergenic
1080566759 11:33516646-33516668 AGGAAGAAAAAGGCAGAGGAGGG - Intergenic
1080919052 11:36690285-36690307 GTGGAGCAAAAGCCAGAGGATGG - Intergenic
1081586631 11:44389482-44389504 AAGGGGAAGATGCCAGGGGATGG - Intergenic
1083230413 11:61314218-61314240 AAGAAGAATATGGCAGAGGAAGG + Intronic
1083293980 11:61705410-61705432 ATGGAGAAAAGGCCAGAGTCAGG - Intronic
1083841902 11:65309349-65309371 ATGGAGAAACACCCAGAGCAGGG - Intergenic
1084465199 11:69319250-69319272 ATGAAGAATATGAGAGAGGAAGG - Intronic
1085460351 11:76689615-76689637 AGGGAGGCAAGGCCAGAGGAGGG + Intergenic
1085642032 11:78198618-78198640 ATGGAAAGAATGGCAGAGGGAGG - Intronic
1089765940 11:120765811-120765833 ATGATGAAACTTCCAGAGGAAGG - Intronic
1089831744 11:121335118-121335140 ATGGAGAGACTGTCAGAGGTGGG - Intergenic
1089874706 11:121708923-121708945 ATGGACCAAAGGCCAGAGGTAGG - Intergenic
1089932049 11:122322681-122322703 CTAGACAAAAGGCCAGAGGAAGG - Intergenic
1090707332 11:129350580-129350602 ATGGAACAAAAGGCAGAGGAAGG + Intergenic
1091149507 11:133314517-133314539 ATGGAAAACATAGCAGAGGAAGG - Intronic
1091374845 12:18490-18512 ATGGAGAAGATCACAGAGGCTGG + Intergenic
1091511443 12:1131260-1131282 GAGGAGGAAATGACAGAGGATGG + Intronic
1092361387 12:7839614-7839636 ATGGAGAAGATGCTGAAGGAGGG + Intronic
1092375831 12:7954878-7954900 ATGGAGAAGATGCTGAAGGAGGG + Intergenic
1092814075 12:12297674-12297696 AGGGGGAAAAAGGCAGAGGAAGG + Intergenic
1093484011 12:19634248-19634270 TTGGAGAAAATGGCAGAAGTAGG + Intronic
1093738274 12:22650192-22650214 ATGGAGAAAATCCAAAAGAATGG - Intronic
1095311771 12:40706676-40706698 ATTCTGAAAATCCCAGAGGAAGG + Intronic
1095514961 12:42995338-42995360 ATGGAGACAAATACAGAGGAAGG + Intergenic
1095903136 12:47349267-47349289 ATTTAGAAAATGACAGAGGTGGG - Intergenic
1096543427 12:52321362-52321384 GTGGAGTAGATGGCAGAGGATGG + Exonic
1096556058 12:52404592-52404614 ATGTGGAAAATTCCAGAGCAAGG - Intronic
1096634576 12:52950019-52950041 AGGGAAAAAATGCCAGGAGAGGG + Intronic
1096870502 12:54589365-54589387 AAGGGGAAAATGCCTGGGGAGGG + Intergenic
1098870774 12:75814624-75814646 AAATAGGAAATGCCAGAGGAAGG - Intergenic
1099001981 12:77188922-77188944 AGGGAGAAAATGCCAGGCAAAGG - Intergenic
1099521164 12:83664794-83664816 ATGGGCAAGATGCCAAAGGAAGG - Intergenic
1099854884 12:88151249-88151271 ATAGGCCAAATGCCAGAGGAAGG - Intronic
1101832056 12:108266102-108266124 ATTGAGAGAATGGGAGAGGATGG - Intergenic
1101868166 12:108538822-108538844 ATGGAGGAAAAGCAAGAGTAGGG + Intronic
1102162432 12:110780620-110780642 ATGTAGAAAATGCTAGAACAAGG + Intergenic
1102376709 12:112427595-112427617 ATATAGATAATGCCAGATGATGG + Intronic
1102468821 12:113147632-113147654 ATGTAGAAGTTGCCAGAGGCTGG + Intergenic
1102739961 12:115198353-115198375 ATGGACAAAATGGAAGAGGGGGG + Intergenic
1103019475 12:117522396-117522418 ATGGAGAGAAGGCCAGGGGTGGG + Intronic
1103221105 12:119246341-119246363 CTAGATAAAATGCCAGAGAATGG + Intergenic
1104371770 12:128229711-128229733 ATAGAGAGAATGCCAGGGAAAGG + Intergenic
1105286969 13:19012351-19012373 ATGGAGGAAATACCAGAGAGGGG + Intergenic
1105962515 13:25354925-25354947 ACGGGGAAAAAGCCAGAGAAGGG + Intergenic
1106371612 13:29139882-29139904 ATGGAGAGAGCGCCAGAGGAAGG - Intronic
1106436709 13:29729696-29729718 CTGGAGTAAATGCAGGAGGAGGG - Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1108313380 13:49217104-49217126 ATGGAGAAAATACCATAGAGAGG + Intergenic
1108395957 13:49991861-49991883 ATGAAGACAAGGCCAGAGGAAGG - Intergenic
1109485834 13:63017984-63018006 ATTTAAAAAATGCCAGAGAATGG + Intergenic
1110793022 13:79606304-79606326 ATGGAGATAAAAACAGAGGAAGG - Intergenic
1111768253 13:92562281-92562303 ATTGAGAGAATGCCACAAGAAGG - Intronic
1112101155 13:96190861-96190883 CTGGTGAAAATGCCAGAAGGTGG + Intronic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1112943693 13:104897790-104897812 ATAGAGAGAATGCAAGAGCAGGG - Intergenic
1114184472 14:20389754-20389776 AGGGAGAAGATGCTAGAGAAGGG + Intronic
1115009693 14:28530197-28530219 ATGAAAAAAATGCAAGAGAATGG + Intergenic
1116209605 14:41918264-41918286 ATGATGAAAATGCCACAGCACGG - Intergenic
1116469510 14:45270459-45270481 AGGGAGAGAATGGCAGAGAAAGG + Intergenic
1116551940 14:46251494-46251516 AGGGAGAAATTGCCAGTGGTGGG - Intergenic
1117214066 14:53531841-53531863 ATGGAGAAAAGGACAAAGGGAGG - Intergenic
1117255748 14:53975754-53975776 ATGAAAAAGAGGCCAGAGGAGGG - Intergenic
1117486567 14:56203929-56203951 ATAGAGAAAATGACAAATGAAGG + Intronic
1118266081 14:64295721-64295743 ATGGAGAAAATGTTAAATGATGG + Intronic
1118489856 14:66248430-66248452 GTGGAGAAAAAGGGAGAGGAAGG + Intergenic
1119019349 14:71094288-71094310 AGAGAGTAAATGCCAGAGGCAGG + Intronic
1119872939 14:78032522-78032544 ATGGAGGAAAGGGGAGAGGAAGG - Intergenic
1121609408 14:95265979-95266001 AGGCACAAGATGCCAGAGGATGG + Intronic
1121615646 14:95311809-95311831 ATGAAGAAGGTGGCAGAGGATGG - Intronic
1122024169 14:98862985-98863007 ATAATGAAAATGACAGAGGAAGG + Intergenic
1122256960 14:100485459-100485481 ACTGAGTAAATGCCAGAGGAAGG + Intronic
1122365975 14:101195070-101195092 ATGGAGAAAACACCAGAGCCAGG + Intergenic
1122557591 14:102590090-102590112 AGGGAGAAATGGCCAGAGGCAGG + Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1122983194 14:105200691-105200713 ATGGAGAAGGGCCCAGAGGATGG - Intergenic
1202837362 14_GL000009v2_random:88025-88047 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1202906748 14_GL000194v1_random:78155-78177 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1124153232 15:27201009-27201031 ATGGAGACTATTCCAGAGGCAGG - Intronic
1124610911 15:31207834-31207856 ATGGATTAAATGCCACAGAAAGG + Intergenic
1125339235 15:38658316-38658338 AGGGAGAGGATGTCAGAGGATGG + Intergenic
1125736374 15:41929205-41929227 TTGGACAAAATCCCAAAGGAAGG - Intronic
1126699303 15:51353583-51353605 ATTGAGAAAATGTGAGTGGAAGG + Intronic
1126840777 15:52715482-52715504 AGAGAGGCAATGCCAGAGGATGG + Intergenic
1127027387 15:54821964-54821986 ATGGGGCAAAGCCCAGAGGAAGG + Intergenic
1127128954 15:55841996-55842018 ATGGAGGAGTTGCCAGAGAATGG - Exonic
1127319577 15:57829802-57829824 TTGGGGAACATGCCAGAGAAGGG - Intergenic
1128689237 15:69710679-69710701 ATGGAGGAGATGTCACAGGAAGG - Intergenic
1128941371 15:71790486-71790508 ATGAAGAACAGGCAAGAGGAAGG + Intergenic
1130177851 15:81593681-81593703 AGGCAGAGAATGGCAGAGGAAGG + Intergenic
1130755400 15:86757658-86757680 ATGGAGAAAATGACAAAAAAGGG - Intronic
1130881810 15:88061786-88061808 ATGGAGAAAATGCCAGTCTGTGG + Intronic
1131045785 15:89314354-89314376 ATCTAGAAAATGGCTGAGGAGGG - Intronic
1131371698 15:91887264-91887286 CTGGGGAAAATGGCCGAGGAAGG - Intronic
1131842498 15:96452287-96452309 ATGGAGAGATGACCAGAGGAAGG + Intergenic
1132451744 15:101972555-101972577 ATGGAGAAGATCACAGAGGCTGG - Intergenic
1132455148 16:18074-18096 ATGGAGAAGATCACAGAGGCTGG + Intronic
1133097893 16:3459555-3459577 ATGTAGAAAATCCCACAAGAAGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133859380 16:9579946-9579968 ATGGAGAAATGGTTAGAGGATGG - Intergenic
1133902230 16:9987805-9987827 ATGGAGAAAATTCCCAAGCATGG + Intronic
1134264608 16:12682415-12682437 CTGTAGAATATGCAAGAGGAGGG + Intronic
1135692949 16:24559008-24559030 TTGGAGTAAATGCCACAAGACGG - Intronic
1136003171 16:27311682-27311704 AGGGAGAGAAGGCCACAGGAAGG - Intergenic
1136925685 16:34371479-34371501 ATGGCTGAAATGACAGAGGATGG + Intergenic
1136978889 16:35040327-35040349 ATGGCTGAAATGACAGAGGATGG - Intergenic
1138448648 16:57079844-57079866 ATGGGGAAAAAGGCAGAAGAAGG - Intronic
1138937920 16:61753034-61753056 ATGGACAAAATTCCAGAGTAAGG + Intronic
1139315847 16:66067797-66067819 ATGAAGACAATGCCATAGAAAGG - Intergenic
1139368368 16:66447919-66447941 ATGTGGAAAATGCCCCAGGAGGG + Intronic
1139781113 16:69352238-69352260 ATGAATACAGTGCCAGAGGATGG + Intronic
1140968878 16:79993845-79993867 GTGAAGAAAGTGCCTGAGGATGG + Intergenic
1141544424 16:84755236-84755258 AGGGCGAAGATGCCAGAGGTGGG - Intronic
1142269535 16:89082008-89082030 ATGGAGATATTCCCAGAGGCTGG + Intergenic
1142690807 17:1605319-1605341 ATGGCCAGAATGCCAGGGGAGGG - Intronic
1142806792 17:2375648-2375670 ACGGAGTAATTGCGAGAGGAGGG - Exonic
1145083186 17:19912827-19912849 AAGGAGAGAAAGGCAGAGGAAGG + Intronic
1145997048 17:29110807-29110829 AAGGAGAGAAAGCCAGAGGTGGG + Intronic
1146543199 17:33715711-33715733 ATGGAAAAGATGCCATTGGAAGG - Intronic
1147559291 17:41499159-41499181 ATGAAGATGGTGCCAGAGGAAGG + Intergenic
1147600057 17:41739781-41739803 CGGGAGAGAATGCCAGGGGAGGG - Intergenic
1148155469 17:45422720-45422742 ATAGAGAAAATGTGAGAGGAAGG + Intronic
1148536135 17:48440602-48440624 AAGGAGAAAATGCCTGGGAAAGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149796917 17:59529255-59529277 ATTGAGAAAATGCAGCAGGATGG - Intergenic
1150387158 17:64771373-64771395 ATAGAGAAAATGTGAGTGGAAGG + Intergenic
1150481836 17:65516863-65516885 AGGGAGAAAATGGGGGAGGAGGG + Intergenic
1150616132 17:66773648-66773670 TTTGAGAAAAAGCCAGAGGCCGG - Intronic
1151021866 17:70626344-70626366 ATGGGGATAATGCCAAATGATGG + Intergenic
1151494579 17:74451839-74451861 ATGAAAAAAATCCCAGAGGCAGG - Intergenic
1151536570 17:74742228-74742250 AAAGAGAAAAAGGCAGAGGATGG - Intronic
1152451469 17:80383903-80383925 CTGCAGGAAATGCCAGAGGATGG - Exonic
1152798451 17:82320207-82320229 ATGGAGCAAAGGCCAGAGGAGGG - Intergenic
1153600671 18:6778183-6778205 ATGGAAAAAATCCTAGAGAAAGG - Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1157150417 18:45211616-45211638 AAGGAGAAAAAAGCAGAGGAGGG - Intergenic
1157414882 18:47493931-47493953 AAGGAGAAAAAGCCAGCGTAAGG - Intergenic
1157678420 18:49584575-49584597 ATGGAGAAAATGCCAGAGGAGGG - Intronic
1157732249 18:50014256-50014278 ATGGAGAAAATGGATGAGAAAGG + Intronic
1158126669 18:54107169-54107191 ATAAAGAAAATGCATGAGGATGG + Intergenic
1159612013 18:70536114-70536136 ATGAAGAAAATGTAAGAGGCCGG - Intergenic
1159846194 18:73463514-73463536 ATGAAAAAAATGCTACAGGAAGG + Intergenic
1160428002 18:78791498-78791520 ATGCAGAGAATGCCAGAGCCAGG - Intergenic
1163002362 19:14376145-14376167 TGGGAGACAATGGCAGAGGAAGG - Intergenic
1163183273 19:15618786-15618808 ATGGTGGAAGTGCCACAGGATGG - Intronic
1163194773 19:15708651-15708673 ATGAATAAAATGACAGAAGAAGG + Intergenic
1163219629 19:15907431-15907453 ATGAATAAAATGACAGAAGAAGG - Intergenic
1164562222 19:29300155-29300177 ATGGTTTAAAGGCCAGAGGATGG - Intergenic
1165371463 19:35409108-35409130 ATGAAGAAAATGTCATAGGCTGG - Intergenic
1165528622 19:36378057-36378079 AGGGAGAAAATTCCACAGGAAGG + Intronic
1166561009 19:43732371-43732393 AGGGAGAGAAAGCCAGAGGCAGG + Intronic
1166978727 19:46620569-46620591 ATGGAGAAGCTGGCAGATGAAGG - Exonic
1167319214 19:48785560-48785582 AGGGAGAAAGAGCTAGAGGAGGG + Intergenic
1168042872 19:53772719-53772741 ATGGAAAAAGGGTCAGAGGAAGG - Intergenic
1168050589 19:53826776-53826798 ATGGAGATAATGCCTGAGTAAGG + Intergenic
1168204374 19:54838527-54838549 ACAGAGAAAGAGCCAGAGGAAGG + Intronic
1202649937 1_KI270706v1_random:170775-170797 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1202694410 1_KI270712v1_random:113952-113974 ATGGAAAGAGTGCCAGAGAATGG + Intergenic
925130731 2:1492487-1492509 ATGGACAAAGTGAAAGAGGAAGG - Intronic
926004316 2:9360984-9361006 AAGAAGAAAATGCCAAAGAAAGG + Intronic
926235389 2:11039290-11039312 TAGGAGAAAACTCCAGAGGAAGG - Intergenic
926744730 2:16141596-16141618 ATGGAGCAAATGCATGAAGATGG - Intergenic
926783163 2:16494320-16494342 AAGGAGAGAATGCCAGGAGAGGG - Intergenic
927174740 2:20397883-20397905 GGGGAGAAAATGGCAGAGGATGG + Intergenic
927416263 2:22883817-22883839 ATGGAAAAAAGGGAAGAGGAGGG + Intergenic
927826086 2:26311172-26311194 GTAGAGGAAATGACAGAGGAAGG + Exonic
927942737 2:27115563-27115585 GTGGAGAAAATACCAGAGACAGG - Intronic
928422062 2:31145283-31145305 AAGGTGAAATAGCCAGAGGATGG - Intronic
929046844 2:37798645-37798667 ATGGGGAAAAAGGCAGAGGGTGG - Intergenic
929829451 2:45335202-45335224 TTCTAGAAAATGCTAGAGGATGG + Intergenic
929876540 2:45801345-45801367 AAGGGGAGAAGGCCAGAGGAGGG + Intronic
930852577 2:55976318-55976340 ATGAAGAAAAAGCCAGATAAGGG + Intergenic
930999137 2:57760138-57760160 GTGGACAAAAGGCCCGAGGAGGG - Intergenic
931086064 2:58831765-58831787 ATGCAGCCACTGCCAGAGGATGG + Intergenic
931660868 2:64561112-64561134 ATAGAGAAAATGAAAAAGGAGGG + Intronic
932439349 2:71722266-71722288 AAGGAGATAATGCTGGAGGATGG + Intergenic
932860205 2:75283634-75283656 ATGGAGAAATGGCCAGAAAATGG - Intergenic
933288392 2:80408855-80408877 ATATAGAAAATGCCAGAGTCAGG - Intronic
933952151 2:87340612-87340634 ATGGAAAGAGTGCCAGAGAATGG - Intergenic
934236395 2:90236950-90236972 ATGGAAAGAGTGCCAGAGAATGG - Intergenic
935082865 2:99815453-99815475 ATGGAGTAAGTGCCAAAGGCAGG - Intronic
936108509 2:109646075-109646097 AAGGACCAAATGCCGGAGGAGGG - Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
936567955 2:113595022-113595044 ATGGAGAAGATCACAGAGGCTGG - Intergenic
937089908 2:119199234-119199256 ATGGAGAAAATGCATCAGGTCGG + Intergenic
937757924 2:125563348-125563370 TTGGAGAAAGGCCCAGAGGAAGG - Intergenic
937884325 2:126889682-126889704 TTAGGCAAAATGCCAGAGGAGGG + Intergenic
939915446 2:148036587-148036609 ATGGAGAAAAAGCCAGTTGATGG - Intronic
940806399 2:158192291-158192313 ACAGAGAAATTGCTAGAGGAGGG + Intronic
942325543 2:174773320-174773342 TTTGAGAAAATGCCAAAGGTAGG - Intergenic
943720908 2:191202743-191202765 AAAGAGAATATGGCAGAGGAAGG + Intergenic
944212901 2:197225051-197225073 AGGGAGAAAAGGGAAGAGGAGGG + Intronic
944556204 2:200890021-200890043 ATGTAGAAAATGCTGGAGAATGG + Intronic
945777455 2:214124898-214124920 ATTGAGTAAATGGCAGAGCAAGG - Intronic
945948340 2:216015355-216015377 ATGGGCAAAACCCCAGAGGAGGG + Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946721644 2:222615320-222615342 ATGGAGAATAGGCCACAGGTTGG - Intronic
946726825 2:222669961-222669983 AAGGAGAAAAGGGCATAGGATGG + Intergenic
946872591 2:224097698-224097720 AAGGAGAAAGTGCAAGAGGCTGG - Intergenic
946953607 2:224904976-224904998 GTGAAGAAAATTACAGAGGAGGG - Intronic
947557921 2:231113704-231113726 ATGTAGAGAATGCCAGAGTGTGG - Intronic
947777010 2:232720982-232721004 AGAGAGAAAAGGCCAGAGGAGGG + Intronic
948425490 2:237884635-237884657 TCGGGGAAGATGCCAGAGGATGG + Intronic
948675886 2:239596428-239596450 ATGCAGAAATTGCTAGAGAAGGG + Intergenic
948856634 2:240733283-240733305 ATGGGGAAACTCCCAGAGGCAGG + Intronic
1169566943 20:6865032-6865054 ATGGAGAAAATCATAGAGGACGG + Intergenic
1169742968 20:8915290-8915312 AGGGAGAAAATGAGAGAGCACGG - Intronic
1169781419 20:9314519-9314541 GTGGAGAGAATGCCAGAGAAGGG + Intronic
1169917174 20:10695250-10695272 AGAGAGAAAAGGCCAGAGGCAGG + Intergenic
1170701270 20:18705753-18705775 AGAGAGAAAATGCCAAAGGTTGG + Intronic
1171881431 20:30620508-30620530 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1172121258 20:32600185-32600207 CTGGAGAAAATGTCAGAGAAGGG + Intronic
1172512886 20:35512892-35512914 ATGGTGGGAGTGCCAGAGGAAGG - Exonic
1173402863 20:42740353-42740375 CTGGATAAAACCCCAGAGGAAGG - Intronic
1173563540 20:44023009-44023031 AGGAAGAGAAGGCCAGAGGAGGG + Intronic
1173810396 20:45951853-45951875 CTGGGGAAAATGCCACAGAAGGG - Intronic
1173822342 20:46027808-46027830 GTGGACATAATGCCAGTGGATGG - Intronic
1174208933 20:48861581-48861603 CTGGACAAAATGACAGTGGAGGG + Intergenic
1174348336 20:49948381-49948403 ACGGAGAAAAGGCCAGAAGGCGG - Intronic
1174355610 20:49995842-49995864 ATGGAGAAAATAACAGGGAAAGG - Intergenic
1174707390 20:52670374-52670396 ATGCAGAAATTTCCAGAGGAAGG - Intergenic
1174961492 20:55162171-55162193 ATGGAGAGAATGCCAGACTGAGG + Intergenic
1175673039 20:60922286-60922308 ATGGGGAAAATGGCAGGGGCAGG + Intergenic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1176601885 21:8801772-8801794 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1176626098 21:9092954-9092976 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1177113598 21:17058712-17058734 ATGGAGAAAAGCCTAGAAGAAGG + Intergenic
1177348934 21:19910054-19910076 ATGCAGAAATTGCCAGGGAAAGG + Intergenic
1178049333 21:28731012-28731034 ATGGGTGAAATGACAGAGGATGG + Intergenic
1178330952 21:31690661-31690683 ATGGAGATACTGACACAGGAGGG + Intronic
1178887676 21:36496656-36496678 ATGGAGAAGAAAGCAGAGGAAGG + Intronic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1180220403 21:46354861-46354883 ATGGGGGAAATGCCAGAGAAGGG + Intronic
1180344170 22:11693323-11693345 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1180365423 22:11933901-11933923 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1180951168 22:19721281-19721303 ATGGAGACCATGCCAGGGGCAGG + Intronic
1181600043 22:23945741-23945763 ATGTAGAAAAGGCCAAGGGAAGG + Intergenic
1181608459 22:23995582-23995604 ATGTAGAAAAGGCCAAGGGAAGG - Intergenic
1182046533 22:27278599-27278621 AAGGAGACAATGACAGAGGGAGG - Intergenic
1182277824 22:29201578-29201600 TAGGAGAAATTGCCAGAGGAGGG + Intergenic
1184092356 22:42299337-42299359 ATGGAGAGAGTGCCAGAGCAGGG - Intronic
1184905249 22:47479312-47479334 TTTCAGAAAATGCAAGAGGAAGG - Intronic
950257460 3:11517577-11517599 ATCCAGAAGAAGCCAGAGGAGGG + Intronic
950573199 3:13814830-13814852 AGGGAGAAACTGCCAGAGCTTGG + Intergenic
950861566 3:16151931-16151953 TTGCAGAAAATGCCAGATGTTGG + Intergenic
952000565 3:28781115-28781137 ATGGAGAGAGGGCAAGAGGAAGG + Intergenic
952144325 3:30515276-30515298 ATGGTGAAAATGACACAGGGAGG - Intergenic
952543212 3:34389790-34389812 ATGGAGATAATGGAAGAGGACGG + Intergenic
953339172 3:42119422-42119444 TTGGAGAAAATAGCAGAGGCTGG + Intronic
953438102 3:42895984-42896006 ATGGTGAAAATGGCAGAATAGGG - Intronic
953455020 3:43034207-43034229 ATGGAGAGAATGGGAGAGGAAGG + Intronic
953465567 3:43116400-43116422 ATAGAGCAAAGGCCAGGGGAAGG + Intergenic
953640953 3:44707131-44707153 ATGAAGAATATGCCATAGGGAGG - Intergenic
953686280 3:45080869-45080891 AGGGAGAGAATGGCAGGGGAAGG - Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954707880 3:52490675-52490697 ATGGAGAAAGGGACAGAGGGAGG - Intronic
954722680 3:52578941-52578963 CTGGAGAAACTGCCAGGGGAAGG + Intronic
957232731 3:77540844-77540866 ATTGAGATAATGCCTGTGGAGGG + Intronic
958065136 3:88535222-88535244 ATGAAAAAAATGCTAGAGGCAGG - Intergenic
958423578 3:93955546-93955568 ATGGAGAACATAACACAGGACGG + Intronic
960038864 3:113129038-113129060 ATGGAGAAAAGGGCACAGGGAGG + Intergenic
960341883 3:116485280-116485302 ATGAAAAATATGCCAGAGGCTGG + Intronic
960499383 3:118418595-118418617 AAGGAGAAAATGCAAGAAAAGGG + Intergenic
961069802 3:123912134-123912156 AGTGACAAAATGCTAGAGGATGG + Intronic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961517195 3:127445270-127445292 ATGTACAAAAGGCCTGAGGATGG + Intergenic
961573437 3:127816660-127816682 ATGGGGGAAGTGCCCGAGGATGG + Intronic
961917093 3:130387710-130387732 AGGGAGAAACTGTAAGAGGATGG + Intronic
961984186 3:131115147-131115169 ATGGAACAAAAGACAGAGGAAGG + Intronic
962713447 3:138107001-138107023 TTGGAGAAGATGCAAGGGGAAGG + Intronic
962952187 3:140229489-140229511 ATGGAGAAAAAGGAAAAGGAGGG - Intronic
963803103 3:149696939-149696961 AAGGGGAAAATGTTAGAGGATGG - Intronic
964034856 3:152183327-152183349 AGGGAGAAATTCCCAGAAGATGG + Intergenic
964204464 3:154157442-154157464 ATGGTGAAAATGCCTCAGCAGGG - Intronic
964367498 3:155965669-155965691 AAAGAGAAACTGCCAGATGATGG - Intergenic
965607977 3:170515525-170515547 AAGGAGAAAATGACAAAGCAGGG + Intronic
966638980 3:182168283-182168305 AAGGAGAAAATAGCAGAGCATGG - Intergenic
966985629 3:185177869-185177891 ATGAAGAAAATGCAAGATCAAGG + Intergenic
967053970 3:185811792-185811814 ATGGAGCACATGGCAGGGGACGG + Intronic
969374534 4:6754437-6754459 GTGTGGAAAATGCCAGAGGGTGG + Intergenic
969682485 4:8651025-8651047 CAGGAGAAAAAGGCAGAGGAAGG + Intergenic
970938393 4:21601797-21601819 ATGGAGGAAAAGCTACAGGAAGG - Intronic
970939620 4:21616133-21616155 ATGATGAAGATGCAAGAGGAAGG - Intronic
971094678 4:23387355-23387377 ATGGAGAGGATGGCAGAGGTAGG - Intergenic
971303382 4:25460480-25460502 ATGTAGAAAATGAAAAAGGAGGG - Intergenic
971632887 4:29017704-29017726 ATGGAGAAAATACAAATGGAAGG - Intergenic
971810151 4:31414428-31414450 ATTGAGAAAGTGAGAGAGGAAGG - Intergenic
971882785 4:32401651-32401673 ATGGCAAAAATAGCAGAGGAAGG + Intergenic
972473841 4:39432311-39432333 ATGGAGAAAATGAGAGACCAGGG + Intronic
972874216 4:43338454-43338476 ATGAAGAAAATGCAATAGGATGG - Intergenic
972997612 4:44901165-44901187 CTGAAGAAAATGACAGAGAAGGG - Intergenic
973066219 4:45796519-45796541 ATGAAAAAAATGCCATAGGCCGG + Intergenic
973093300 4:46165045-46165067 AAAGAGAAAATGACAGAGTAGGG - Intergenic
973365208 4:49203579-49203601 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
973395384 4:49588875-49588897 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
974661244 4:64892326-64892348 ATGTATAAAATGGCAAAGGAAGG + Intergenic
975457086 4:74605053-74605075 ATAGAGAAATTTCTAGAGGAGGG + Intergenic
975475876 4:74822773-74822795 AGGGAGAATATGAGAGAGGAAGG - Intergenic
975815460 4:78212283-78212305 ATGCAGCGAATGCAAGAGGAAGG - Intronic
976956545 4:90908261-90908283 ATGCAGAAGATTCCAGATGAAGG + Intronic
977895268 4:102357632-102357654 AAGGAGAGAATGAAAGAGGAAGG + Intronic
978206293 4:106084086-106084108 ATGGACAAAGTGACAGAAGAAGG + Intronic
978292410 4:107158241-107158263 GTGTAGAAAATACCAGAGTAAGG - Intronic
978926087 4:114246476-114246498 ATGGAAAAAAGTACAGAGGAGGG + Intergenic
979224865 4:118273218-118273240 ATGGAGATAATGGTAGAGCAGGG - Intergenic
979865751 4:125751153-125751175 ATGGAGAAAGTGGCAGAGAATGG - Intergenic
980489517 4:133506677-133506699 ATGGATAAATTGGCAGAGGTAGG + Intergenic
980521306 4:133939043-133939065 ATTCAGAAAATTCAAGAGGAGGG + Intergenic
980656179 4:135789895-135789917 ATGAAGAAAATGTCAGTGAAAGG - Intergenic
981074364 4:140576777-140576799 GTGGAGATCATGCCAAAGGATGG - Intergenic
981279311 4:142939096-142939118 TAGAAGAAAATGGCAGAGGAAGG + Intergenic
981407628 4:144389680-144389702 ATGGAGAATATTGCAAAGGAGGG + Intergenic
982242184 4:153311424-153311446 ATAGACAAAAGGCTAGAGGAAGG + Intronic
982799144 4:159681141-159681163 ATAAAGAAAATGCCAGAAGGAGG + Intergenic
983514702 4:168643918-168643940 ATGGAGGAAATGACAGAGCCAGG + Intronic
983980391 4:173988804-173988826 ATAGAGAAAATGACAGAGTTTGG + Intergenic
984006413 4:174315061-174315083 ATGGAGCAAATGGCAGAAGTAGG + Intronic
984516405 4:180746797-180746819 AAGGAGAAAGTGTCAGAGTAGGG - Intergenic
984586686 4:181572293-181572315 AGGGAGAAAATCCCAAAGGTAGG + Intergenic
984785994 4:183567733-183567755 ATGGAACAAAAGGCAGAGGAAGG - Intergenic
985314426 4:188640481-188640503 ATGGAGAAAGGGCAAGAGGGAGG - Intergenic
1202762589 4_GL000008v2_random:125206-125228 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
985815122 5:2122427-2122449 ATGAAGAAATTATCAGAGGAAGG - Intergenic
985825208 5:2186159-2186181 CTGGACAAAATCCCACAGGAGGG + Intergenic
986067074 5:4245210-4245232 ATGGAGGAAAGGACAGATGAAGG - Intergenic
987250279 5:16093548-16093570 ATACAGAAAATGGAAGAGGATGG - Intronic
987392482 5:17388860-17388882 AAGGAAAAAATGCAAAAGGAGGG - Intergenic
987442827 5:17978072-17978094 ATGAAGAAAATGGGAGAGGCAGG + Intergenic
987811162 5:22838110-22838132 ATGAAGAAAATGGCAAAGCAAGG - Intronic
988294103 5:29332686-29332708 ATAGAGAAAATGAGAGAGGCTGG + Intergenic
988330366 5:29830303-29830325 ATGGAGAAACAGCCAGATGGTGG + Intergenic
989452040 5:41597797-41597819 ATAGAGTAAAAGGCAGAGGAAGG - Intergenic
989657002 5:43755361-43755383 ATGGAGAAAATTCCAGCTCATGG - Intergenic
990511385 5:56492429-56492451 ATGCAGAAATTTCCAGAGAAGGG + Intergenic
990722338 5:58710683-58710705 AGGGAGAAGATACCAGAGAAAGG - Intronic
991454367 5:66786470-66786492 ATATAGAAAATGACATAGGAGGG + Intronic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
992588987 5:78273562-78273584 AAGGACAAAATTACAGAGGAGGG + Intronic
993698173 5:91086784-91086806 GTGGAGAGAATGCTAGAGGCAGG - Intronic
994042009 5:95269548-95269570 TTGGAGAGAAGGCTAGAGGAAGG - Intronic
994067063 5:95555216-95555238 AGGGAGAGAACGCCAGAGGGAGG + Exonic
994356630 5:98800551-98800573 ATGGAGCAAGTGACAGAGAAGGG + Intergenic
995640622 5:114252677-114252699 ACAGAGAAAATGGCAGAGGTTGG - Intergenic
996220889 5:120931911-120931933 ATGGAGCAAAGACCACAGGACGG + Intergenic
996580760 5:125029626-125029648 ATGGGAAAAAGGGCAGAGGAGGG - Intergenic
999550044 5:152676716-152676738 TTGGAGAATATGTCAGAGGAAGG + Intergenic
1000116584 5:158159702-158159724 ATGAAGAAACTGCCCAAGGAAGG - Intergenic
1000378956 5:160611762-160611784 ATGGAGAAAACGAAAGAAGACGG - Intronic
1000856197 5:166401307-166401329 AAGGGAAAAATGCCAGAGGTGGG - Intergenic
1001267286 5:170283097-170283119 ATGGAGAAAATATCAAGGGAAGG - Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001788954 5:174437952-174437974 ATGGACAAATTGACAGAAGAAGG + Intergenic
1002792784 6:447889-447911 AGGGAGAACGAGCCAGAGGAAGG + Intergenic
1003417062 6:5919176-5919198 ATGGGGAAAAAGCTAGAGAAGGG - Intergenic
1003935118 6:10968243-10968265 CTGAAGAAACTGCTAGAGGAGGG + Intronic
1004017455 6:11745035-11745057 AGGGAGAGAAGGCCAGAGGCAGG - Intronic
1004314933 6:14578234-14578256 CTGGAGAAAATTCCACTGGATGG + Intergenic
1004349925 6:14882151-14882173 AGGGAGCAAAGACCAGAGGAAGG + Intergenic
1005952880 6:30644412-30644434 ATGGAGGAAAGGAGAGAGGAAGG - Intronic
1006510282 6:34517644-34517666 TTGGAGCAAAGGCCTGAGGAAGG - Intronic
1006516116 6:34546686-34546708 GTGGAGAAAATGCCAGCAGGAGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008145951 6:47891550-47891572 ATGGAGAAAATACTAGAGTAAGG - Intronic
1009369095 6:62879106-62879128 AAGGAAAAAATGTCAGAGGGAGG - Intergenic
1010186677 6:73152331-73152353 AGGTAGAAAATGAAAGAGGAAGG - Intronic
1010916829 6:81630055-81630077 TTAGAGAAAACTCCAGAGGAGGG - Intronic
1011332832 6:86228663-86228685 ATGGAGCACATGCCAAAGCAGGG - Intergenic
1012334156 6:98032951-98032973 ATGGACAAAAAGCCAGAGGTGGG + Intergenic
1012451459 6:99356463-99356485 GGGGAGAAGATGTCAGAGGATGG + Intergenic
1012499197 6:99869830-99869852 ATTTAGCAAATGGCAGAGGAGGG + Intergenic
1013629566 6:111973122-111973144 TTGGAGGAAAAACCAGAGGACGG - Intergenic
1014025987 6:116646545-116646567 GTGAAGAAAATGCCAGCGGTGGG + Intronic
1014625889 6:123724159-123724181 ATGGAGAAAATGAAATAGGCAGG - Intergenic
1014922243 6:127227482-127227504 AAAGAGAAAATGCCAGAGTAAGG - Intergenic
1015209587 6:130682190-130682212 ATGAAGAAAGGGCCAGGGGAGGG - Intergenic
1015797915 6:137031737-137031759 ATCAAGAAAATGAAAGAGGATGG + Intronic
1017641073 6:156494461-156494483 ATGGAGCTAGGGCCAGAGGACGG + Intergenic
1017944651 6:159085525-159085547 ATGGAAAAAAGACCAGAGGAAGG - Intergenic
1018184867 6:161257919-161257941 GTTGAGAAAGTGCCAGAGCAAGG - Intronic
1018812377 6:167307396-167307418 ATTGAGACAGTTCCAGAGGATGG + Intronic
1019049345 6:169171121-169171143 GTGGAGAAAATGCCCTACGAGGG + Intergenic
1019867677 7:3727952-3727974 TTGGAGAAACTGCCAGAGACTGG - Intronic
1020208757 7:6141715-6141737 ATTCAGAAAATGCAAGAGGCAGG - Intronic
1021123256 7:16820883-16820905 ATGGGGAAAATGATAGATGATGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021741817 7:23694212-23694234 ATGGAGAATATGACAGAATATGG - Intronic
1022673374 7:32476621-32476643 ATGGAGAAAGTGCAAGAGTTTGG + Intergenic
1022752466 7:33244441-33244463 ATAGAAAAGATCCCAGAGGAAGG - Intronic
1023300886 7:38769825-38769847 ATGGAGATGGGGCCAGAGGAGGG - Intronic
1024097480 7:45994655-45994677 AAGCAGAAAATGGCAGAGTAGGG + Intergenic
1024101494 7:46037076-46037098 GTGGAGTCAATCCCAGAGGATGG - Intergenic
1024138488 7:46435016-46435038 ATGGAGAAAATGCCATGTGTAGG - Intergenic
1024412685 7:49064065-49064087 TTGTAGAAAAGCCCAGAGGAAGG + Intergenic
1024525296 7:50343271-50343293 ATGGAGAAAAGAAGAGAGGAAGG - Intronic
1024644043 7:51356484-51356506 ATGGAGACAAAGCCAGAGCAGGG - Intergenic
1024839115 7:53563750-53563772 ATGACAAAAATGCCAGAGGTTGG + Intergenic
1025605748 7:63038798-63038820 ATGTGGACAATGCCACAGGAGGG + Intergenic
1025832296 7:65063062-65063084 ATGGGCAAAATGCATGAGGATGG + Intergenic
1025902065 7:65752579-65752601 ATGGGCAAAATGCATGAGGATGG + Intergenic
1026181108 7:68041676-68041698 AGGGAGGAAACGTCAGAGGAAGG + Intergenic
1026772923 7:73213495-73213517 ATGAAGAAAATGTCACATGAAGG - Intergenic
1027013786 7:74766891-74766913 ATGAAGAAAATGTCACATGAAGG - Intergenic
1027074252 7:75179141-75179163 ATGAAGAAAATGTCACATGAAGG + Intergenic
1028887719 7:95952793-95952815 ATGCATAAAAGGACAGAGGAAGG - Intronic
1029040276 7:97565970-97565992 ATGGAACAAAAGGCAGAGGAAGG - Intergenic
1029153122 7:98495392-98495414 CTGGAGAATATTACAGAGGAAGG + Intergenic
1029403734 7:100360661-100360683 ATGGAGGAATGGCCAGAGGTGGG + Intronic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1029843344 7:103388588-103388610 GTGGAGGAAATGACAGTGGAAGG + Intronic
1030659880 7:112207003-112207025 GCGGAGAAAATGCCATGGGATGG + Intronic
1030864610 7:114684326-114684348 ATTCAGAAACTGTCAGAGGAGGG + Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032738498 7:134714379-134714401 AGGGAGAACCTGCCAGAGGAAGG - Intergenic
1032798634 7:135300345-135300367 ATGGAGATGTTGCCAGAGGTAGG + Intergenic
1033068070 7:138175349-138175371 ATGGAGAAAAGGAGAAAGGAAGG + Intergenic
1033460064 7:141538829-141538851 AGGGAGAAAATACCAGAGTGAGG + Intergenic
1033519830 7:142149354-142149376 AAAGAGAAGAGGCCAGAGGATGG - Intronic
1033583697 7:142758951-142758973 TTGGAGAAAATGCCAAAGTGGGG - Intronic
1034243531 7:149627062-149627084 AAGGAGAAAATTCCAGTAGAAGG + Intergenic
1034731050 7:153387833-153387855 GAGGAGAGAATGCAAGAGGATGG + Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1036565048 8:9931327-9931349 GTGTAGATTATGCCAGAGGATGG + Intergenic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1038730669 8:30124177-30124199 ATGAAGAAAATGCCAGAAGAGGG + Intronic
1039109139 8:34022595-34022617 ATGGGGAACATTCTAGAGGAGGG + Intergenic
1039227458 8:35403909-35403931 ATGGAGAGAATGTCAGTGGAGGG - Intronic
1039354762 8:36802721-36802743 AGGGGGAAAATGCCAGGGGAAGG - Intronic
1039440792 8:37594087-37594109 AGGGAGAAAAAGGCAGAGGGAGG + Intergenic
1039685790 8:39801003-39801025 ATGGAGTAATTGACAGAAGATGG - Intronic
1039900047 8:41745203-41745225 AGGGAGAAATTGTCAGAGGAGGG + Intronic
1040659288 8:49550903-49550925 TTGCAGAAAATGGAAGAGGATGG - Intronic
1041121412 8:54590253-54590275 AGTGATACAATGCCAGAGGAGGG - Intergenic
1041231344 8:55756372-55756394 ATGGAAAAAATACCAGAAGATGG - Exonic
1041598460 8:59686211-59686233 ATGGAGAAAAACTGAGAGGAAGG + Intergenic
1041640529 8:60195083-60195105 TTGGAGAAAATCCCAAAGGGAGG - Intronic
1041682703 8:60609279-60609301 ATGGAACACATTCCAGAGGAGGG - Intronic
1042799475 8:72703146-72703168 ATGGAGAAAATGGCATAGCTAGG - Intronic
1043593279 8:81854739-81854761 ATTGAGAACATACCAGAGGTTGG - Intergenic
1043724197 8:83589059-83589081 ATAGACAAAATGGCAGAAGAAGG + Intergenic
1044341645 8:91052766-91052788 ATGGTGAAAATGGCACAAGAAGG + Intergenic
1045029776 8:98124074-98124096 ATGCAGAAATGGGCAGAGGATGG + Intronic
1046761207 8:118022836-118022858 ATGGAGGTAATGCCTGGGGAAGG + Intronic
1046997552 8:120541291-120541313 GTGGAGAGAGGGCCAGAGGAGGG - Intronic
1047434642 8:124826010-124826032 ATGGGGAGAATGCCACATGAAGG - Intergenic
1047777393 8:128084239-128084261 AGGGGGAAAGTGGCAGAGGAAGG - Intergenic
1048106391 8:131415013-131415035 TAGGATAAAATGGCAGAGGAAGG - Intergenic
1048502860 8:134994503-134994525 AAGGAGAAGATGCCTGTGGAAGG + Intergenic
1049884575 9:18498-18520 ATGGAGAAGATCACAGAGGCTGG + Intergenic
1050589215 9:7145242-7145264 ATAGAGAATATGCAAAAGGATGG - Intergenic
1050860134 9:10418510-10418532 ATGGAGAAAATTACAGCAGAAGG - Intronic
1051269223 9:15338780-15338802 ATGGTGAAAATGCCAAATGCTGG - Intergenic
1052791787 9:32881909-32881931 AGGGAGAAAATGCCAAACCATGG + Intergenic
1055569838 9:77605410-77605432 TTTGAGAAAATGACAGAGGCAGG + Intronic
1055656126 9:78452091-78452113 ATGGAGAACATCACAGAAGAAGG - Intergenic
1055956236 9:81776178-81776200 ATAAAGAAAATGCTATAGGAAGG - Intergenic
1056162038 9:83906387-83906409 CTGGAGAACCTGCCAGAGGAGGG - Intronic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1056358291 9:85825082-85825104 CTGGAGATCCTGCCAGAGGAGGG + Intergenic
1056850962 9:90083487-90083509 ATGACTAAAATGCCATAGGATGG + Intergenic
1058719237 9:107748708-107748730 ATGAAGGAGATGACAGAGGATGG - Intergenic
1058848670 9:108988467-108988489 ATGGAGACAAGGGCAGAGGCAGG - Intronic
1058894957 9:109391763-109391785 TTTGAAAAAATGCCATAGGAAGG + Intronic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059589608 9:115644445-115644467 ATGGAGAGAATGCCAGGACAAGG - Intergenic
1060041266 9:120303749-120303771 ATGGAGAGAAAGCCAGTGGAAGG + Intergenic
1060478961 9:124006557-124006579 ATGTAGAAACTCCCGGAGGAGGG - Intronic
1061180566 9:129022873-129022895 AGGGAGAGGGTGCCAGAGGAGGG + Intronic
1061326917 9:129869622-129869644 GTGCAGACATTGCCAGAGGATGG + Intronic
1061398986 9:130358170-130358192 AGGGAGAAAATGTCAGTGGGGGG + Intronic
1061594509 9:131620207-131620229 ATGGAGAAGATGCCCAAGGATGG + Intronic
1061926916 9:133810424-133810446 AGGAAGAAGAAGCCAGAGGATGG - Intronic
1203749270 Un_GL000218v1:63375-63397 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1203543349 Un_KI270743v1:110087-110109 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1186311707 X:8326794-8326816 ATGGAGAAAAGAGTAGAGGATGG - Intergenic
1186451859 X:9680550-9680572 ATGGAGAAAATGTCAGCAGCAGG - Intronic
1186900010 X:14043931-14043953 ATTGAGAAAATGGCAGAAGCAGG - Intergenic
1187011461 X:15284301-15284323 AAGGAGAAAATGCAAATGGAAGG + Intronic
1187812997 X:23200728-23200750 AAGAAGAAAATGGCAGACGACGG + Intergenic
1188303045 X:28529027-28529049 AGGGAGAAAATGAAAGAGGGAGG + Intergenic
1188992990 X:36846868-36846890 ATGGAGAAAATGCAAAAACATGG + Intergenic
1189645115 X:43119924-43119946 ATGGACAAAAAGCAAGGGGATGG - Intergenic
1189943146 X:46148561-46148583 ATTCAGAAAATCTCAGAGGAGGG - Intergenic
1190288912 X:48978966-48978988 AGGGAGAAAATGGAAGAGGTTGG + Intronic
1190301755 X:49061068-49061090 AGGGAGCAAACTCCAGAGGAGGG + Intronic
1190759569 X:53428239-53428261 ATGGAGAAGATACCCCAGGAGGG - Intronic
1192336307 X:70223205-70223227 ATGGGGCAAATGCCAAAGCAGGG + Intergenic
1194484416 X:94470456-94470478 ACTGAGAAAATGGCAGAGGTTGG + Intergenic
1195374184 X:104210226-104210248 ATGGAGAAAGTATCATAGGAAGG + Intergenic
1195924591 X:110012887-110012909 CTGGAGGAAATGGCAGAGGGAGG + Intronic
1196310900 X:114163880-114163902 ATGGATAAAAGGCAAGATGAAGG - Intergenic
1196733517 X:118964193-118964215 AGGGAAAAAATGACTGAGGAAGG - Intergenic
1197007874 X:121524863-121524885 ATGGAAAAAAAAACAGAGGATGG + Intergenic
1197343336 X:125300820-125300842 ATGGGGAAGATGTCATAGGATGG + Intergenic
1197462452 X:126759079-126759101 ATGTAGTTAATGGCAGAGGAAGG - Intergenic
1197769607 X:130081859-130081881 CTGGAGAAACTGCCAGATGGAGG + Intronic
1198058218 X:133016562-133016584 AGTGATAAAATTCCAGAGGAAGG - Intergenic
1198067909 X:133118278-133118300 ATGGAGGAATTGCATGAGGAAGG + Intergenic
1198102391 X:133433182-133433204 CTGGACAAAATGGCAGAGCAAGG - Intergenic
1198323687 X:135545073-135545095 ATGGAGTAAGGGGCAGAGGAAGG - Intronic
1198514384 X:137389955-137389977 ATGGAAAAAATTCCAGAGGAAGG - Intergenic
1198841433 X:140861482-140861504 AGGGCAGAAATGCCAGAGGAAGG + Intergenic
1199297635 X:146177060-146177082 AAGCTGAAAATGCCAGAGCAGGG + Intergenic
1199965948 X:152821180-152821202 ATGGAGATAATGCCACAGTGGGG - Intergenic
1200401231 X:156021653-156021675 ATGGAGAAGATCACAGAGGCTGG - Intergenic
1200761108 Y:7039907-7039929 ATGGAGAAAATGTCAGAAGCAGG - Intronic
1201162630 Y:11178386-11178408 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1201545914 Y:15161973-15161995 CGGAACAAAATGCCAGAGGAAGG - Intergenic
1201688151 Y:16730757-16730779 ATGGACAAAATGTGAGAGGTTGG - Intergenic