ID: 1157680726

View in Genome Browser
Species Human (GRCh38)
Location 18:49603363-49603385
Sequence GAGTGTGGCCAGAGGGCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157680726_1157680732 -6 Left 1157680726 18:49603363-49603385 CCATCCGCCCTCTGGCCACACTC No data
Right 1157680732 18:49603380-49603402 ACACTCCCCTGTTGTGCAGTGGG No data
1157680726_1157680737 1 Left 1157680726 18:49603363-49603385 CCATCCGCCCTCTGGCCACACTC No data
Right 1157680737 18:49603387-49603409 CCTGTTGTGCAGTGGGGACCTGG No data
1157680726_1157680731 -7 Left 1157680726 18:49603363-49603385 CCATCCGCCCTCTGGCCACACTC No data
Right 1157680731 18:49603379-49603401 CACACTCCCCTGTTGTGCAGTGG No data
1157680726_1157680733 -5 Left 1157680726 18:49603363-49603385 CCATCCGCCCTCTGGCCACACTC No data
Right 1157680733 18:49603381-49603403 CACTCCCCTGTTGTGCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157680726 Original CRISPR GAGTGTGGCCAGAGGGCGGA TGG (reversed) Intergenic
No off target data available for this crispr