ID: 1157682741

View in Genome Browser
Species Human (GRCh38)
Location 18:49619604-49619626
Sequence CACCACTCAGAGATGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157682741_1157682747 6 Left 1157682741 18:49619604-49619626 CCTGGGGCCATCTCTGAGTGGTG No data
Right 1157682747 18:49619633-49619655 CCAAAATGTTGGAACGAGGATGG No data
1157682741_1157682744 -5 Left 1157682741 18:49619604-49619626 CCTGGGGCCATCTCTGAGTGGTG No data
Right 1157682744 18:49619622-49619644 TGGTGGCTGAGCCAAAATGTTGG No data
1157682741_1157682745 2 Left 1157682741 18:49619604-49619626 CCTGGGGCCATCTCTGAGTGGTG No data
Right 1157682745 18:49619629-49619651 TGAGCCAAAATGTTGGAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157682741 Original CRISPR CACCACTCAGAGATGGCCCC AGG (reversed) Intergenic
No off target data available for this crispr