ID: 1157683983

View in Genome Browser
Species Human (GRCh38)
Location 18:49628348-49628370
Sequence ACTCCTGGTGAGACATTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157683981_1157683983 -1 Left 1157683981 18:49628326-49628348 CCAGCTGCTTGGCTAACTGGTTA No data
Right 1157683983 18:49628348-49628370 ACTCCTGGTGAGACATTTCCTGG No data
1157683977_1157683983 19 Left 1157683977 18:49628306-49628328 CCCTGCACACTGGCAGAAGTCCA No data
Right 1157683983 18:49628348-49628370 ACTCCTGGTGAGACATTTCCTGG No data
1157683978_1157683983 18 Left 1157683978 18:49628307-49628329 CCTGCACACTGGCAGAAGTCCAG No data
Right 1157683983 18:49628348-49628370 ACTCCTGGTGAGACATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157683983 Original CRISPR ACTCCTGGTGAGACATTTCC TGG Intergenic
No off target data available for this crispr