ID: 1157684473

View in Genome Browser
Species Human (GRCh38)
Location 18:49631264-49631286
Sequence CCTTCGGTACTAACGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157684473_1157684481 3 Left 1157684473 18:49631264-49631286 CCATGTGCCGTTAGTACCGAAGG No data
Right 1157684481 18:49631290-49631312 GGGAGCACTCGCTTTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157684473 Original CRISPR CCTTCGGTACTAACGGCACA TGG (reversed) Intergenic
No off target data available for this crispr