ID: 1157684481

View in Genome Browser
Species Human (GRCh38)
Location 18:49631290-49631312
Sequence GGGAGCACTCGCTTTCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157684470_1157684481 12 Left 1157684470 18:49631255-49631277 CCTTTGACCCCATGTGCCGTTAG No data
Right 1157684481 18:49631290-49631312 GGGAGCACTCGCTTTCTCCCTGG No data
1157684468_1157684481 18 Left 1157684468 18:49631249-49631271 CCCAGGCCTTTGACCCCATGTGC No data
Right 1157684481 18:49631290-49631312 GGGAGCACTCGCTTTCTCCCTGG No data
1157684467_1157684481 19 Left 1157684467 18:49631248-49631270 CCCCAGGCCTTTGACCCCATGTG No data
Right 1157684481 18:49631290-49631312 GGGAGCACTCGCTTTCTCCCTGG No data
1157684479_1157684481 -4 Left 1157684479 18:49631271-49631293 CCGTTAGTACCGAAGGTGGGGGA No data
Right 1157684481 18:49631290-49631312 GGGAGCACTCGCTTTCTCCCTGG No data
1157684469_1157684481 17 Left 1157684469 18:49631250-49631272 CCAGGCCTTTGACCCCATGTGCC No data
Right 1157684481 18:49631290-49631312 GGGAGCACTCGCTTTCTCCCTGG No data
1157684466_1157684481 30 Left 1157684466 18:49631237-49631259 CCTAGGATGTTCCCCAGGCCTTT No data
Right 1157684481 18:49631290-49631312 GGGAGCACTCGCTTTCTCCCTGG No data
1157684472_1157684481 4 Left 1157684472 18:49631263-49631285 CCCATGTGCCGTTAGTACCGAAG No data
Right 1157684481 18:49631290-49631312 GGGAGCACTCGCTTTCTCCCTGG No data
1157684471_1157684481 5 Left 1157684471 18:49631262-49631284 CCCCATGTGCCGTTAGTACCGAA No data
Right 1157684481 18:49631290-49631312 GGGAGCACTCGCTTTCTCCCTGG No data
1157684473_1157684481 3 Left 1157684473 18:49631264-49631286 CCATGTGCCGTTAGTACCGAAGG No data
Right 1157684481 18:49631290-49631312 GGGAGCACTCGCTTTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157684481 Original CRISPR GGGAGCACTCGCTTTCTCCC TGG Intergenic
No off target data available for this crispr