ID: 1157685753

View in Genome Browser
Species Human (GRCh38)
Location 18:49641024-49641046
Sequence CGCAGCACGAGGAGACCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157685753_1157685758 -1 Left 1157685753 18:49641024-49641046 CCTCCGGGTCTCCTCGTGCTGCG No data
Right 1157685758 18:49641046-49641068 GGCAGCAGAGTGTGATTTGAGGG No data
1157685753_1157685763 29 Left 1157685753 18:49641024-49641046 CCTCCGGGTCTCCTCGTGCTGCG No data
Right 1157685763 18:49641076-49641098 AGAGTGAAGCTGGTTTTGCCTGG No data
1157685753_1157685757 -2 Left 1157685753 18:49641024-49641046 CCTCCGGGTCTCCTCGTGCTGCG No data
Right 1157685757 18:49641045-49641067 CGGCAGCAGAGTGTGATTTGAGG No data
1157685753_1157685761 19 Left 1157685753 18:49641024-49641046 CCTCCGGGTCTCCTCGTGCTGCG No data
Right 1157685761 18:49641066-49641088 GGGCAGGGCCAGAGTGAAGCTGG No data
1157685753_1157685759 3 Left 1157685753 18:49641024-49641046 CCTCCGGGTCTCCTCGTGCTGCG No data
Right 1157685759 18:49641050-49641072 GCAGAGTGTGATTTGAGGGCAGG No data
1157685753_1157685760 4 Left 1157685753 18:49641024-49641046 CCTCCGGGTCTCCTCGTGCTGCG No data
Right 1157685760 18:49641051-49641073 CAGAGTGTGATTTGAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157685753 Original CRISPR CGCAGCACGAGGAGACCCGG AGG (reversed) Intergenic