ID: 1157686691

View in Genome Browser
Species Human (GRCh38)
Location 18:49648449-49648471
Sequence CACTCCACACTCATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157686679_1157686691 28 Left 1157686679 18:49648398-49648420 CCACTGTGTTCTCCCCAGTGAAT No data
Right 1157686691 18:49648449-49648471 CACTCCACACTCATGGAGCTGGG No data
1157686685_1157686691 1 Left 1157686685 18:49648425-49648447 CCTAGGCCCAGTGTCTGCTGAGG No data
Right 1157686691 18:49648449-49648471 CACTCCACACTCATGGAGCTGGG No data
1157686682_1157686691 16 Left 1157686682 18:49648410-49648432 CCCCAGTGAATATGGCCTAGGCC No data
Right 1157686691 18:49648449-49648471 CACTCCACACTCATGGAGCTGGG No data
1157686688_1157686691 -6 Left 1157686688 18:49648432-49648454 CCAGTGTCTGCTGAGGTCACTCC No data
Right 1157686691 18:49648449-49648471 CACTCCACACTCATGGAGCTGGG No data
1157686684_1157686691 14 Left 1157686684 18:49648412-49648434 CCAGTGAATATGGCCTAGGCCCA No data
Right 1157686691 18:49648449-49648471 CACTCCACACTCATGGAGCTGGG No data
1157686687_1157686691 -5 Left 1157686687 18:49648431-49648453 CCCAGTGTCTGCTGAGGTCACTC No data
Right 1157686691 18:49648449-49648471 CACTCCACACTCATGGAGCTGGG No data
1157686683_1157686691 15 Left 1157686683 18:49648411-49648433 CCCAGTGAATATGGCCTAGGCCC No data
Right 1157686691 18:49648449-49648471 CACTCCACACTCATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157686691 Original CRISPR CACTCCACACTCATGGAGCT GGG Intergenic
No off target data available for this crispr