ID: 1157691110

View in Genome Browser
Species Human (GRCh38)
Location 18:49682664-49682686
Sequence CAAACTTAACAACGTGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157691108_1157691110 0 Left 1157691108 18:49682641-49682663 CCTGTAAGTCAAAGGTTTGTTGT No data
Right 1157691110 18:49682664-49682686 CAAACTTAACAACGTGGACCAGG No data
1157691107_1157691110 4 Left 1157691107 18:49682637-49682659 CCATCCTGTAAGTCAAAGGTTTG No data
Right 1157691110 18:49682664-49682686 CAAACTTAACAACGTGGACCAGG No data
1157691104_1157691110 15 Left 1157691104 18:49682626-49682648 CCGGCCAAGAGCCATCCTGTAAG No data
Right 1157691110 18:49682664-49682686 CAAACTTAACAACGTGGACCAGG No data
1157691103_1157691110 18 Left 1157691103 18:49682623-49682645 CCTCCGGCCAAGAGCCATCCTGT No data
Right 1157691110 18:49682664-49682686 CAAACTTAACAACGTGGACCAGG No data
1157691102_1157691110 25 Left 1157691102 18:49682616-49682638 CCTGTCACCTCCGGCCAAGAGCC No data
Right 1157691110 18:49682664-49682686 CAAACTTAACAACGTGGACCAGG No data
1157691105_1157691110 11 Left 1157691105 18:49682630-49682652 CCAAGAGCCATCCTGTAAGTCAA No data
Right 1157691110 18:49682664-49682686 CAAACTTAACAACGTGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157691110 Original CRISPR CAAACTTAACAACGTGGACC AGG Intergenic
No off target data available for this crispr