ID: 1157696038

View in Genome Browser
Species Human (GRCh38)
Location 18:49724469-49724491
Sequence CACCTGCCTGTACCTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157696038_1157696042 10 Left 1157696038 18:49724469-49724491 CCAATGCCAGGTACAGGCAGGTG No data
Right 1157696042 18:49724502-49724524 CATGCGACCTGTGCCGTGGTGGG No data
1157696038_1157696041 9 Left 1157696038 18:49724469-49724491 CCAATGCCAGGTACAGGCAGGTG No data
Right 1157696041 18:49724501-49724523 GCATGCGACCTGTGCCGTGGTGG No data
1157696038_1157696040 6 Left 1157696038 18:49724469-49724491 CCAATGCCAGGTACAGGCAGGTG No data
Right 1157696040 18:49724498-49724520 CAAGCATGCGACCTGTGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157696038 Original CRISPR CACCTGCCTGTACCTGGCAT TGG (reversed) Intergenic
No off target data available for this crispr