ID: 1157703807

View in Genome Browser
Species Human (GRCh38)
Location 18:49783800-49783822
Sequence CTGGCCAAGTAGAGTAAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157703801_1157703807 21 Left 1157703801 18:49783756-49783778 CCAGTTGTGGCAGCTGCTCTGAA 0: 2
1: 0
2: 1
3: 45
4: 1189
Right 1157703807 18:49783800-49783822 CTGGCCAAGTAGAGTAAGGATGG 0: 1
1: 0
2: 0
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157703807 Original CRISPR CTGGCCAAGTAGAGTAAGGA TGG Exonic
901149679 1:7092970-7092992 CTGGCCAAGCCCAGTAAGAATGG + Intronic
902053899 1:13584495-13584517 CTGGCCTCGTAGAATCAGGAGGG + Intronic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
903868000 1:26412213-26412235 CTGGCCCAGGAATGTAAGGAAGG - Intronic
906290879 1:44618557-44618579 TTGGCCAGGTAGAACAAGGAGGG + Intronic
906654949 1:47541400-47541422 GTGTCCAAGTAGAGTTAGAAGGG + Intergenic
906931046 1:50169775-50169797 CTGACTGAGTAGAGTAGGGAAGG - Intronic
908541395 1:65126034-65126056 CTGCCCAAGTTGACTGAGGAGGG + Intergenic
908677303 1:66619650-66619672 CAGGACAAGGAGAGAAAGGAGGG + Intronic
914332246 1:146683154-146683176 CAGGCCAAGCTGAGTAAGAAGGG + Intergenic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
915467366 1:156105397-156105419 GCTGCCAAGTAGAGTAGGGATGG - Intronic
915630576 1:157151181-157151203 CTGGGAAGGAAGAGTAAGGAAGG + Intergenic
917631066 1:176891911-176891933 TTGGCCTAGGAGTGTAAGGAAGG + Intronic
918248125 1:182678669-182678691 CTGGACAAGGAGAGAAATGATGG + Intronic
919878164 1:201885637-201885659 ATGGCCCAGGAAAGTAAGGAAGG + Intergenic
1065388751 10:25160169-25160191 CTGGCTAAGGACAGTAAGAAGGG + Intergenic
1066586158 10:36938886-36938908 TGGGCCAGGTAAAGTAAGGATGG - Intergenic
1067551436 10:47239150-47239172 CTTGCCAGGTAGAGTGTGGAAGG - Intergenic
1070191291 10:74114120-74114142 CTGGCCATGTTAAGGAAGGAAGG - Intronic
1071303312 10:84274145-84274167 ATGGTCAAGTAAAGTAAGGGTGG + Intergenic
1075446312 10:122515907-122515929 ATGACCTAGTAGAGTCAGGAAGG + Intergenic
1076887293 10:133268562-133268584 CTGGCCGAGTGGAGCCAGGAAGG + Intronic
1077522352 11:3043778-3043800 CAGGCCAAGGGGAGGAAGGAGGG + Intronic
1079438713 11:20486169-20486191 CTGGGCAAGAAGAGAATGGATGG + Intronic
1082206292 11:49438790-49438812 CTGGCCTCGTAGAGTAAGTCAGG + Intergenic
1083635627 11:64119337-64119359 CTGGCCAAGCTGAGCCAGGATGG - Intronic
1084705292 11:70812818-70812840 CTGGCCAAGAACAGCCAGGAGGG + Intronic
1085901989 11:80711271-80711293 TGGGCCAAGTAAAGTAGGGATGG + Intergenic
1087842295 11:102933015-102933037 ATGGCCAAGTTGTGTAAGTATGG + Intergenic
1087958316 11:104317516-104317538 CTGGCCTGGTAGATGAAGGAAGG - Intergenic
1090474081 11:127003935-127003957 CTGGCCAAGAAGTGACAGGAGGG + Intergenic
1090552934 11:127842514-127842536 CTGGACAAGCAGAGTTAGGGTGG - Intergenic
1092083854 12:5739677-5739699 CTGGAGAAGTAAAGTAAGGATGG + Intronic
1094368090 12:29705551-29705573 CTGGACAAGCAGTGTAAGCAAGG - Intronic
1097225513 12:57474974-57474996 CTGGGGAAGTAGAGTGAGGCGGG + Intronic
1097579723 12:61440172-61440194 ATGGGCAATTAGAGTAAGGCAGG + Intergenic
1100280294 12:93112132-93112154 CTAGCCAAAGAGAGTAAGGAGGG - Intergenic
1101072231 12:101087761-101087783 CTGGGCAAGTACAATTAGGAAGG - Intronic
1101133946 12:101719890-101719912 CTAGCCAAGTACAGTAGTGAGGG - Intronic
1106441946 13:29782565-29782587 CAGGCCAGGGGGAGTAAGGAGGG - Intronic
1108701075 13:52944643-52944665 CTGGGTAAGGAGAGCAAGGAGGG + Intergenic
1112119140 13:96390738-96390760 CTGCCCAGAAAGAGTAAGGAAGG - Intronic
1118893546 14:69927997-69928019 CTGGGCAAGTAGGGAAAGGAGGG + Intronic
1121978365 14:98428175-98428197 CTGGCTGTATAGAGTAAGGAAGG + Intergenic
1123718903 15:23046995-23047017 CTGGCCAGGTGGAGTTATGATGG - Intergenic
1125732912 15:41904164-41904186 CTGGCCCAGCAGACAAAGGAGGG + Intronic
1128890888 15:71330955-71330977 CTGGCCTTGTCGAGGAAGGAGGG + Intronic
1130924093 15:88372282-88372304 CTGGCAAAGAAAAGTAGGGAAGG + Intergenic
1137582898 16:49644863-49644885 GAGGCCAAGTAGAGCAAGAAAGG + Intronic
1138971658 16:62151494-62151516 CTGGTCTAATAGAGGAAGGAAGG - Intergenic
1139100272 16:63758134-63758156 CTGGCCATGTAGAATGAGGTTGG - Intergenic
1139648191 16:68347107-68347129 CTGGGCAAGTGGAGTGAGAAGGG + Intronic
1140001306 16:71027765-71027787 CAGGCCAAGCTGAGTAAGAAGGG - Exonic
1141984864 16:87573136-87573158 GTGGCCAAGTGGGGTAAGGTAGG + Intergenic
1143538181 17:7554143-7554165 CTGGGCATGAAGAGTAGGGAGGG - Intronic
1143576178 17:7794602-7794624 AAGCCCAAGTAGACTAAGGAAGG + Intronic
1145041829 17:19582785-19582807 ATGGCCAAGTGGATTAAGGACGG + Intergenic
1145042581 17:19587925-19587947 ATGGCCAAGTGGATTAAGGACGG - Intergenic
1151706560 17:75772061-75772083 AAGGCCAAGTTGAGCAAGGAGGG - Intergenic
1152378410 17:79930118-79930140 CTGCCCAAGTCGGGGAAGGAGGG - Intergenic
1153340721 18:3971934-3971956 CTGGTCCAGTTGAGTAAGGGAGG + Intronic
1157703807 18:49783800-49783822 CTGGCCAAGTAGAGTAAGGATGG + Exonic
1157730101 18:49996183-49996205 GTAGCCTAGTAAAGTAAGGAGGG - Intronic
1158719530 18:59911912-59911934 CTTGCTAAGTAGAGTTAAGAGGG - Intergenic
1158930001 18:62314664-62314686 ATGGCCGAGTAGATTATGGAAGG + Intergenic
1162500786 19:11052469-11052491 ATGGCCAGGTGGAGGAAGGAGGG - Intronic
1163014899 19:14448718-14448740 CGGCCCAAGGAGAGTAAGGCAGG - Intronic
1166597388 19:44061913-44061935 CAGGCCAAGTAAAGATAGGATGG - Intronic
1167494804 19:49811463-49811485 CTGGCCTAGGAGAGGAAGAAGGG + Exonic
1168271849 19:55254449-55254471 CTGTCCAAGCAGGGGAAGGAAGG - Intronic
926704210 2:15825392-15825414 CTGACCCAGCAGAGGAAGGAAGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
928642949 2:33319600-33319622 CTGGCCAAGTGCAGCAAGGAAGG - Intronic
929151084 2:38750136-38750158 CTGGCAAAGGAGAGTTAGAAAGG - Exonic
929853937 2:45619825-45619847 ATGGTCATGTAGACTAAGGAAGG - Intergenic
932006528 2:67933165-67933187 CTGGCCATGTAGAGTGAAAAGGG + Intergenic
932799189 2:74724330-74724352 CTGGCTGCGTAGAGTGAGGAAGG - Intergenic
932838731 2:75061408-75061430 GTGGCCAAGTATATTAAGAATGG - Intronic
935441150 2:103097313-103097335 CTAGCCAAGTAGGAAAAGGATGG - Intergenic
935454733 2:103254115-103254137 CTGGCCAAATTGAGTCAGGTAGG - Intergenic
938154257 2:128917064-128917086 CTGGCCACATAGAATAAGGTAGG + Intergenic
938792887 2:134692453-134692475 CAGCCCAAGCAGACTAAGGAGGG - Intronic
939956796 2:148534169-148534191 CTGGCCAAGAAGGGTCAGGTTGG - Intergenic
1170705242 20:18738568-18738590 ATGGCCAAGGATAGGAAGGAAGG + Intronic
1172689172 20:36778704-36778726 AGGGCCCAGTAGAGAAAGGATGG + Exonic
1172828005 20:37806797-37806819 CTGTCCAATCAGAGTTAGGAGGG + Intronic
1174402764 20:50284806-50284828 CTGGCCAGGCAGAGAAAGCACGG - Intergenic
1175335592 20:58193821-58193843 CTGGCCAGGTAGAGATGGGAAGG - Intergenic
1175570581 20:60017118-60017140 CTGGCCTCATAGAGTAAGAAAGG + Intronic
1182528133 22:30934407-30934429 TTGGCCAGGTAGACTAAGGTGGG - Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
950460659 3:13120395-13120417 CGGGCCAAGTAGGGCAAGGATGG + Intergenic
950998317 3:17528625-17528647 CTGCCCAAGTAGAGAATGGGGGG - Intronic
951043022 3:18009179-18009201 CTGGGCAAGTACAGGAAGGAAGG - Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
954492171 3:50916426-50916448 TTGGCCATGTAGAGAATGGAAGG - Intronic
954979015 3:54726461-54726483 CTGGGCAAGAAGAGCAAGGCTGG + Intronic
955981104 3:64528650-64528672 TTGGCCAAGGTGACTAAGGAAGG - Intronic
955986513 3:64579099-64579121 TTGGGCAAGTAGAGGAAGGAGGG - Intronic
956400947 3:68879099-68879121 CTGGCCAATTAAAGAAATGATGG - Intronic
956490901 3:69770811-69770833 GAGGCCAAGTAGAGTAGGAATGG + Intronic
957418724 3:79940034-79940056 GTGGGCAAGTAGAGAAAGAAAGG - Intergenic
960876695 3:122303063-122303085 CAGTTCAAGTAGAGAAAGGAAGG - Intergenic
962892937 3:139688664-139688686 CTAGCCAAGGAGAGCAAGGGAGG - Intergenic
963812638 3:149794050-149794072 CTGGAAAAGAAGAGTAATGAGGG + Intronic
965440666 3:168709436-168709458 CTGCCCATGTAGAGGCAGGAAGG + Intergenic
965590517 3:170357232-170357254 CTGGGCGACTAGAGGAAGGAAGG + Intergenic
968431405 4:561208-561230 CTGGCCCAGGACAGTAGGGAGGG + Intergenic
968769222 4:2493230-2493252 TTGGCCAAGTAAAGAAAGGGAGG + Intronic
970900312 4:21151339-21151361 CAGCCCAAGTAGACTAAGGGAGG - Intronic
971768520 4:30866155-30866177 TTTGCCAAGTAAAGAAAGGAGGG - Intronic
973624658 4:52759324-52759346 CAGGTCAACTAGAGCAAGGATGG - Intergenic
978199026 4:106003449-106003471 CTGTCCACTTAGAGTAATGAAGG - Intronic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
982942931 4:161581448-161581470 CTGGCCAAGTTTAGCTAGGACGG + Intronic
985700635 5:1369858-1369880 CTGCCCAAGTAGAGTTAGCAGGG - Intergenic
985828098 5:2207649-2207671 CACGCAAAGTAGAGTGAGGAAGG + Intergenic
988517464 5:31917225-31917247 GTGGCCAAGGAGAGTTAAGAAGG + Intronic
991944233 5:71883938-71883960 CTGGCCAAGTAGTGTAATTCTGG + Intergenic
995539681 5:113172399-113172421 CTGACCAAGTACAGTGAGAAGGG - Intronic
1000826318 5:166048825-166048847 ATGACAAAGTAGAGTAAGAATGG + Intergenic
1001062902 5:168509122-168509144 ATTGCAAAGTAGATTAAGGAAGG + Intronic
1002332607 5:178454975-178454997 CTGGCCAAGGACACCAAGGATGG - Intronic
1005699409 6:28384987-28385009 CTGGCCTTGTGGAGTTAGGAGGG + Intronic
1006730800 6:36234888-36234910 ATGGCCAAGGACAGCAAGGAAGG + Intergenic
1007812645 6:44497240-44497262 CTGGTCAGGTAGAGTCATGAAGG + Intergenic
1026206939 7:68265922-68265944 GTGGCCAAGATGAGTCAGGATGG - Intergenic
1027600139 7:80230259-80230281 CTTGGCAAGTAGAGAATGGAGGG + Intergenic
1028295082 7:89119385-89119407 CTGGCCAAATAGAGATAAGAGGG - Intronic
1028956728 7:96701910-96701932 AAGCCCAAGTAGAGCAAGGAGGG + Intronic
1029121485 7:98270956-98270978 CTGGCAAAATAGAATAATGACGG + Intronic
1029651024 7:101891692-101891714 CTGGCCAGGGAGAATAGGGAAGG + Intronic
1030021203 7:105276952-105276974 CAGGAGAAGTAGAGTTAGGATGG - Intronic
1030844586 7:114393408-114393430 GAGCCCAAGCAGAGTAAGGAAGG + Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035034001 7:155883682-155883704 GTGGCCAGGCAGAGTAAGCAGGG + Intergenic
1035170430 7:157014395-157014417 CTTCCCAAGTAGTGGAAGGAAGG - Intergenic
1039274349 8:35918930-35918952 CTGGCCAAGTAGAAAAAGCCAGG - Intergenic
1041877045 8:62701286-62701308 CTGGTCATGTGTAGTAAGGAGGG - Intronic
1042576009 8:70219512-70219534 CTGGCCAAGCCAAGGAAGGATGG + Intronic
1046784839 8:118254753-118254775 CAGGCCAAGGAGATCAAGGAGGG - Intronic
1047993128 8:130307443-130307465 CACGCCAAGTAGACTAGGGATGG + Intronic
1049273925 8:141710371-141710393 GAGGCTAAGTAGAGAAAGGATGG - Intergenic
1049834761 8:144728054-144728076 ATGACCAAGTTTAGTAAGGAAGG - Intronic
1054812100 9:69443078-69443100 CTGGCCAAGCATAGTAAAGCTGG - Intronic
1057582915 9:96303417-96303439 CTGGCCACAGAGAGTAAGGGAGG + Intergenic
1058736971 9:107902636-107902658 TTAGCCAAGGAGAGTAAGAATGG + Intergenic
1059541536 9:115135316-115135338 CTGGCAAAGTAGGGTAATCAAGG - Intergenic
1062123125 9:134844940-134844962 CTGGCCACCCAGAGAAAGGAAGG + Intergenic
1062460502 9:136660790-136660812 CTCCCCAAGAAGAGGAAGGAAGG + Intronic
1189273593 X:39768949-39768971 CTGACCAAGCAGATTCAGGAGGG + Intergenic
1190036444 X:47029398-47029420 GTGGCAGAGTAGAGTAGGGAAGG + Intronic
1190257710 X:48775946-48775968 CTGGCCAAGTAGAATAAGAGTGG + Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1196174793 X:112628581-112628603 CTGCCCAAATGCAGTAAGGAGGG - Intergenic
1196415743 X:115469187-115469209 ATGGCCAACTAGAGCAGGGATGG + Intergenic
1198212686 X:134530263-134530285 GAGCCCAAGTGGAGTAAGGAGGG - Intergenic
1199682983 X:150240256-150240278 CTGCCCCAGGAGAGTATGGAAGG + Intergenic
1199846332 X:151695077-151695099 CTGGCCGAGTGGAGGAAGGAGGG - Intergenic
1201560745 Y:15313824-15313846 TTGGCTTAATAGAGTAAGGATGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic