ID: 1157711215

View in Genome Browser
Species Human (GRCh38)
Location 18:49850934-49850956
Sequence AGCCCAGGGCTGCTCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 303}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157711204_1157711215 21 Left 1157711204 18:49850890-49850912 CCAACTCTTGGGGCCACAAGACT 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG 0: 1
1: 0
2: 0
3: 27
4: 303
1157711214_1157711215 -10 Left 1157711214 18:49850921-49850943 CCAGTGAATGGGGAGCCCAGGGC 0: 1
1: 0
2: 2
3: 25
4: 297
Right 1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG 0: 1
1: 0
2: 0
3: 27
4: 303
1157711212_1157711215 -9 Left 1157711212 18:49850920-49850942 CCCAGTGAATGGGGAGCCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 363
Right 1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG 0: 1
1: 0
2: 0
3: 27
4: 303
1157711206_1157711215 8 Left 1157711206 18:49850903-49850925 CCACAAGACTTGGCCAGCCCAGT 0: 1
1: 0
2: 1
3: 15
4: 246
Right 1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG 0: 1
1: 0
2: 0
3: 27
4: 303
1157711210_1157711215 -5 Left 1157711210 18:49850916-49850938 CCAGCCCAGTGAATGGGGAGCCC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG 0: 1
1: 0
2: 0
3: 27
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157711215 Original CRISPR AGCCCAGGGCTGCTCCAGAC TGG Intronic
900094689 1:935528-935550 ACCCCACGGCTGCTCCAGGGAGG - Intronic
900614222 1:3557380-3557402 AGCCAAGGGCAGCTGCAGCCGGG - Intronic
901185744 1:7371989-7372011 AGCCCAGGACTTCCCCAGGCTGG - Intronic
901415075 1:9110974-9110996 GGCACAGGGCTGCTGCAGACAGG - Intronic
902608097 1:17580422-17580444 AGCACAGGGCAGCCCCAGAAAGG - Intronic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
903795799 1:25928002-25928024 AGCCCAGAGCAGCTACAGAGAGG - Intergenic
904453583 1:30632645-30632667 AGCCCAGGACTTCTCCATTCTGG + Intergenic
904595784 1:31644558-31644580 AGCCCAGGCCAGCGCCAGCCTGG + Intronic
905043186 1:34976911-34976933 TGCCCAGCGGTGCTCCAGGCAGG + Intergenic
905230507 1:36512302-36512324 AGCCCCGGGCTGCTCCAAATGGG - Intergenic
905393155 1:37650933-37650955 AGCCCAGGACCTCTCCAGCCTGG - Intergenic
905894834 1:41538861-41538883 AGGCCAGGGCTGCTCATGGCTGG - Intronic
906480275 1:46194880-46194902 AGCCCAGGGCAGGGCCAGCCTGG + Exonic
907316460 1:53575757-53575779 AGCCCAGTGCTGCTCCTGCATGG - Intronic
907328996 1:53659208-53659230 AGTCCAGGCCTGCTCTTGACTGG - Intronic
907560858 1:55386121-55386143 AGCCCATGGCTGCAGCAGAGGGG + Intergenic
907862506 1:58367204-58367226 AGCCCAGGCCTGTTCAAGAGTGG + Intronic
908612822 1:65881358-65881380 ACCCCATGGCTGCCCCAGCCAGG - Intronic
912246519 1:107965932-107965954 AGCCCTGGGCAGCTCCTGCCGGG + Intergenic
915333912 1:155129686-155129708 ATCCCAGGGCTGCTGCCCACTGG - Intronic
916743599 1:167667228-167667250 AGCCCAGGGATGCTCAAGGCAGG - Intronic
917652821 1:177095831-177095853 TGCCTGGGGCTGTTCCAGACTGG - Intronic
920116151 1:203623306-203623328 ACCCCAGCTCTGCTGCAGACAGG - Intergenic
922180685 1:223230749-223230771 AGCCCAGGTATGCTCTAGACAGG + Intronic
922206895 1:223455927-223455949 AGCCCAGCGCTGCTACTTACTGG + Intergenic
922542346 1:226428878-226428900 AGCCTAGTGCTTCTCCACACTGG - Intergenic
922570776 1:226633687-226633709 AGCTCAGGTCTGCGCCAGGCAGG - Exonic
922825276 1:228513355-228513377 AGCCCTGGGGTGTTCCACACTGG - Intergenic
1063065840 10:2607677-2607699 AGCCGAGAGTTGCTCCAGCCTGG + Intergenic
1065177809 10:23095798-23095820 AGCCTAGGGCCGGTCCAGGCCGG + Intronic
1065210322 10:23396402-23396424 AGCCCAGAGCTCCTGCAGGCTGG + Intergenic
1065421559 10:25550421-25550443 ATCTCAGGGCTGTTTCAGACGGG + Intronic
1066063682 10:31746332-31746354 AGCCCCTGCCTGCTCCTGACTGG - Intergenic
1067103487 10:43350018-43350040 GCCCCAGGGCTGGTCCAGGCAGG - Intergenic
1067135277 10:43602281-43602303 AGCCCAGGGCAGCTCCTGCATGG + Intergenic
1067552222 10:47244107-47244129 AGCCCCAGTGTGCTCCAGACAGG + Intergenic
1068949216 10:62760695-62760717 GGCCCAGGCCTGCAACAGACGGG + Intergenic
1068991436 10:63155265-63155287 TGCTCAGGGCTGCTCTAGGCTGG + Intergenic
1069732049 10:70623167-70623189 AGCCCAGGGCTCAGCCAGAGTGG + Intergenic
1070400699 10:76051059-76051081 GCCCCAGGGCTGCTCCATGCAGG - Intronic
1070790843 10:79188419-79188441 AGCCCAGGGCGCCTTCAGGCAGG + Intronic
1070863994 10:79694939-79694961 AGCTCAGGGGTGCCCCAGACAGG + Intergenic
1071477456 10:86036812-86036834 AGCCCACGGCTTCTGCAGCCTGG + Intronic
1071491485 10:86139454-86139476 AGGCCAGGCCCGCTCCAGTCAGG - Intronic
1071514082 10:86285495-86285517 AGCCCAGGGCCCCTGCCGACTGG + Intronic
1071630893 10:87217165-87217187 AGCTCAGGGGTGCCCCAGACAGG + Intergenic
1072474114 10:95742334-95742356 AGGCCTAGGCTTCTCCAGACGGG - Intronic
1073250510 10:102118066-102118088 ACCCCAGGGCTGCTCAAGGTGGG + Intronic
1073286982 10:102395398-102395420 ATCCCAAGGTTGCTCCAGACCGG + Intronic
1073914548 10:108387039-108387061 ACCCCAGTGCAGCTCCAGATGGG + Intergenic
1075090674 10:119442501-119442523 AGCCCAAGGCTGCTCTCTACTGG - Intronic
1076007014 10:126955988-126956010 AGCCCAGGTCTGGTCAAGTCGGG + Intronic
1076233261 10:128839358-128839380 AGCCCTGGCCTGCTTCTGACAGG - Intergenic
1076484663 10:130808363-130808385 GGCCCAGAGCTGCTGCAAACTGG - Intergenic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1078662053 11:13295572-13295594 GGCCCCAGGCTGGTCCAGACTGG - Intronic
1080557498 11:33430742-33430764 CTCCCAGGGCTGCTTCTGACAGG - Intergenic
1083235672 11:61349327-61349349 CTCCCAGGGCTGCTGCACACTGG + Exonic
1083290418 11:61686855-61686877 AGCCCCTGGCTGCTCCTGATGGG + Intronic
1083587648 11:63872180-63872202 AGCCCAAGGCTGCCACAGAGAGG - Intronic
1083959766 11:66008028-66008050 AGTCCTGGGCTGCTCCACAGGGG - Intergenic
1084652952 11:70499753-70499775 AGCCCGGGGCTGCTGCAGAGAGG + Intronic
1086909808 11:92459167-92459189 TGCCCAGGGCTGCACCATTCAGG - Intronic
1086974148 11:93113887-93113909 ATCTCAGGCCTGCTCCTGACAGG - Intergenic
1088117315 11:106327290-106327312 AACCCAGGGCTACTGGAGACAGG - Intergenic
1089215073 11:116830224-116830246 AGCCCAGTCCTACCCCAGACAGG + Intronic
1090225947 11:125072442-125072464 GGCCCCCGGCTGCTCCAGATGGG - Intronic
1090247631 11:125227981-125228003 AACCCAGGCTTGCTCCAGCCAGG - Intronic
1090381827 11:126332695-126332717 AGACCAGGGCTGAACCAGGCTGG - Intronic
1090435929 11:126686261-126686283 TCCCAAGGCCTGCTCCAGACTGG + Intronic
1091544782 12:1494293-1494315 AGCCCTGGGCTGCTCAGGAGGGG + Exonic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1096218151 12:49809680-49809702 AGCCCAGGGCTGATCTTGGCTGG - Intronic
1096782197 12:53997903-53997925 AGCCCAGGGCGGCTGAGGACCGG - Intronic
1100460296 12:94792903-94792925 AGCCGAGGGCTGCAGCAGGCAGG - Intergenic
1100642058 12:96491528-96491550 AGCCCTGGGATGCTCCAGCATGG + Intronic
1102548438 12:113673640-113673662 AACCCAGTGCTGCTCCCCACTGG - Intergenic
1103923227 12:124410325-124410347 AGCCCAGGGATGGAGCAGACCGG - Intronic
1104390693 12:128388599-128388621 AGCCCAGTGCTGGTCCAAGCTGG - Intronic
1105303638 13:19155034-19155056 ATCCCAGCCCTTCTCCAGACAGG + Intergenic
1106074801 13:26448802-26448824 AGCCTAGGGCAGATCCAGAATGG - Intergenic
1106487002 13:30180989-30181011 AGCCAAGGGCTGGTACAGATGGG + Intergenic
1106554592 13:30798694-30798716 AGCCCTGGGGTGCTCTGGACAGG - Intergenic
1111822346 13:93228347-93228369 AGACGAGGCCGGCTCCAGACCGG - Intronic
1112309000 13:98301193-98301215 TGCCCAGGGCTCCTCCAGGTGGG - Intronic
1112840638 13:103573342-103573364 AGCCCAGGACTCCCCCACACTGG + Intergenic
1113531801 13:111032624-111032646 AGCCCAGGGGGGTTCCTGACGGG + Intergenic
1114080306 14:19197975-19197997 AGGCCAGGGCTGGTACAGAGGGG - Intergenic
1114660204 14:24338955-24338977 GCCCCAGAGCTGCTCCAGCCAGG - Intronic
1115652070 14:35409856-35409878 TGCGCAGGGCTGCTCCTGCCAGG + Intergenic
1118422678 14:65623981-65624003 AACCCAGGGCTTCTGCAGAATGG + Intronic
1118768989 14:68929222-68929244 AGACCAAGGCTGCCCCAGGCTGG - Intronic
1118772614 14:68952260-68952282 AGCCCTGGGCAGCTTCTGACAGG + Intronic
1119223829 14:72929079-72929101 CGCCCGGGGCTGCTCCCTACTGG + Intronic
1121118968 14:91364019-91364041 AGCCCAGTGGTGCTCTGGACAGG + Intronic
1121492097 14:94368282-94368304 ACCCCAGGGGTGCTCCACAGGGG - Intergenic
1121779444 14:96613018-96613040 ATCTCAGGGCTACACCAGACTGG - Intergenic
1122602981 14:102930430-102930452 AGCCGAGGGGCGCTCCAGCCGGG - Exonic
1122755236 14:103973485-103973507 AGCTCAGGCCCACTCCAGACAGG + Intronic
1123115701 14:105893087-105893109 ATCCCAGGCCGGCTGCAGACTGG - Intergenic
1123119940 14:105911803-105911825 ATCCCAGGCCGGCTGCAGACTGG - Intergenic
1124137027 15:27043839-27043861 GGCCCAGCACTGCTGCAGACTGG - Intronic
1125490896 15:40147680-40147702 GCCCCAGGGCAGCTCCAGAAGGG + Intergenic
1125743866 15:41986087-41986109 AGGCGAAGGATGCTCCAGACAGG - Intronic
1127752531 15:62060207-62060229 AGCCGAGGGCTGCTCCGTCCGGG - Intronic
1128731248 15:70022949-70022971 AGCGCAGGCCAGCCCCAGACTGG + Intergenic
1130041052 15:80405108-80405130 GGACCAGGGCTGCTCCACGCTGG - Intronic
1131080073 15:89527189-89527211 AGCCCAGGGCCCCTGCAGTCAGG - Intergenic
1134043949 16:11087921-11087943 AGCCCAGGGCGGCTGCACAGCGG - Intronic
1135053391 16:19210898-19210920 AGCCCAGCTCTCCTCCTGACAGG - Intronic
1135422968 16:22316948-22316970 GGCTCAGGGCTGATCCAGGCTGG - Intronic
1135613452 16:23888682-23888704 AACCCAGGGAAGGTCCAGACAGG - Intronic
1135975899 16:27108961-27108983 AGCCCAGGGCTGTGCCAGGAGGG - Intergenic
1136245900 16:28975536-28975558 AGCTCTGGGCTCATCCAGACCGG + Exonic
1136249077 16:28991868-28991890 ATCCCAGGGCTGCTCCTCACTGG - Intergenic
1137965605 16:52930074-52930096 AGCCCAGCTCTCCTGCAGACGGG + Intergenic
1138270987 16:55695647-55695669 AGCCCAGGGCTGGTACAGAGAGG - Intronic
1138526983 16:57614537-57614559 AGGCCAGGCCTGCTCCTGGCTGG + Intronic
1140338893 16:74138110-74138132 AGGCCAGGGCTGCTTCTGCCTGG + Intergenic
1141036440 16:80630355-80630377 CACCCAGGGCTGCTCCACAGAGG + Intronic
1141505940 16:84478751-84478773 TGCCCAGGGCTGCTCCCGAGGGG - Exonic
1141810252 16:86371261-86371283 AGCCTGGGACTCCTCCAGACCGG + Intergenic
1142032052 16:87843515-87843537 AGCCCAGGGCAGCTGGACACAGG + Intronic
1142238655 16:88935186-88935208 AACCCAGGACTGCCCCTGACCGG - Intronic
1143969954 17:10788314-10788336 AGCCTAGGGCAGCTCTAGACTGG - Intergenic
1144090604 17:11852559-11852581 AACCAGGGGCTGCTCCAGGCTGG - Intronic
1144801623 17:17932606-17932628 ATCCCATGCCTGCTCCAGAGAGG - Intronic
1146955197 17:36933244-36933266 AGTCCAGGGGTGCTCCGGGCTGG + Intergenic
1147311010 17:39596232-39596254 AGCCCAGGCCTGGCACAGACAGG + Intergenic
1147653937 17:42077915-42077937 TGCCCAGGGCGGCTCCCCACTGG + Intergenic
1152307611 17:79530448-79530470 AGCCCAGGGCTGCGGCACAAAGG - Intergenic
1152331214 17:79674395-79674417 AGCCCAGGGCACCCCAAGACAGG + Intergenic
1154321122 18:13353745-13353767 AGCCCAAGGCTACACCAGGCTGG + Intronic
1155185353 18:23382827-23382849 AGCCCAGGGCTGCTCACTCCAGG + Intronic
1155509650 18:26563567-26563589 AGCCCAGGCCTGCTGAAGTCAGG - Intronic
1156383089 18:36581634-36581656 TGGCCAGGGCTCCTCCAGATAGG - Intronic
1156499337 18:37547262-37547284 CACCCAAGGCTGCTCCAGCCTGG - Intronic
1157187260 18:45551394-45551416 AGCGCAGAGCTGCAGCAGACTGG + Intronic
1157449418 18:47774051-47774073 AGCCCAGGCCTGGACCAGGCTGG - Intergenic
1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG + Intronic
1160404767 18:78637945-78637967 AGCCCAGGCCTCCTGCAGGCGGG + Intergenic
1160501964 18:79406062-79406084 AGCCCAGAGCTGCGCCACACGGG - Intronic
1160766138 19:808917-808939 AGCCGAGGGCTGCTCAAGGGAGG + Intronic
1160944417 19:1634586-1634608 AGCCAAGGAATGCTCCAGGCTGG + Intronic
1161200316 19:3010977-3010999 AGACGAGGCCTGCTCCAGACAGG + Intronic
1161500360 19:4611270-4611292 ACCCCAGGGGTGCCCCAGAGAGG - Intergenic
1162142864 19:8595305-8595327 GGCTCAGAGCTCCTCCAGACAGG + Intronic
1163149375 19:15401942-15401964 CGCCCAAGGCTGCTCCTCACAGG + Intronic
1163822912 19:19506323-19506345 TGCTCAGGGCTGCTGCCGACCGG - Exonic
1164956377 19:32390307-32390329 AGCACAGGGTTGCTCCAGGTGGG - Intergenic
1165132271 19:33640441-33640463 AGACCAGGGCAGCTCCAGAAAGG - Intronic
1165146841 19:33736282-33736304 AGCCCAGGTGGGCTCCAGGCTGG - Intronic
1166553735 19:43684353-43684375 AGCACAGGGCTGCACCAAAAGGG - Intergenic
1167070685 19:47220661-47220683 GGGCCTGGGCTTCTCCAGACCGG - Intergenic
1167493119 19:49803050-49803072 AGCCCAGGCCAGGTGCAGACAGG + Intronic
1168689596 19:58368736-58368758 AGCCCGGGGCTGCTCCACCAAGG + Exonic
925146514 2:1586533-1586555 AACACAGGGCTGATCCACACAGG + Intergenic
925249654 2:2421596-2421618 ATCCCAGGGCAGGTCCAGAAAGG + Intergenic
927090257 2:19705202-19705224 AGCCCAGGGCTTCTACACAGTGG - Intergenic
927477567 2:23425654-23425676 AGCCAAGGGCTGCTCCTTTCGGG - Intronic
928125264 2:28611149-28611171 AGCCCAGGGTTGTGGCAGACAGG - Intronic
928172269 2:29011369-29011391 AGCCCAGGGTGGCTCCAGGATGG - Intronic
932307622 2:70715221-70715243 ATGCCAGGGCTGCTCTAGAGAGG + Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932818032 2:74877263-74877285 AGCCCAGAGCTTCTCAACACCGG + Exonic
934852856 2:97712557-97712579 GGCCCAGGGCAGTTCCACACAGG + Intergenic
935832069 2:107010700-107010722 TGCCCAGCCCTGCTCCAGCCAGG - Intergenic
936083274 2:109449499-109449521 AGCCCAGGGCTCGTCCAGGATGG - Intronic
936284649 2:111172892-111172914 AGCCAGGGTCTGCCCCAGACAGG + Intergenic
937861178 2:126711655-126711677 TGCCCAGATCTGCTGCAGACAGG + Intergenic
939015220 2:136895202-136895224 AGCCCTGGGATGCTGCAGGCAGG + Intronic
939134070 2:138273423-138273445 CGCCCATTGCTGCTCCTGACTGG - Intergenic
939482454 2:142766618-142766640 ATCACACCGCTGCTCCAGACTGG + Intergenic
939533007 2:143389227-143389249 AGCCCAGGTCTGCACCAGATGGG + Intronic
941400385 2:165022937-165022959 AGCCCTGGGATGATCAAGACAGG + Intergenic
941693304 2:168524451-168524473 AGCTCAGTGCTGCTCCATGCTGG + Intronic
942387229 2:175455324-175455346 AGCACCAGGCTGCTCCAGGCAGG - Intergenic
942444813 2:176070904-176070926 AGCCCAGGGCTGCTGCTGGGAGG - Intergenic
944244390 2:197516392-197516414 AGCCCAGGGCTTCGGCAGGCAGG - Intronic
944798939 2:203216529-203216551 AGCCCAGGACTTCACCAGCCTGG + Intronic
946402122 2:219473652-219473674 AGCCCAGGTCTGGCCCAGCCTGG + Intronic
946419692 2:219557856-219557878 CTCCGGGGGCTGCTCCAGACTGG + Exonic
947927719 2:233936253-233936275 AGCCCAGGGCTGACTCAGAGTGG + Intronic
947931484 2:233968545-233968567 TGCCTAGGGCTACTCCAGCCAGG - Intronic
948786104 2:240353741-240353763 AGGCCAGCTCTGCTCCAGAGCGG - Intergenic
948888254 2:240894460-240894482 AGCCCAGGGCTCCTTCAGCAGGG - Intronic
1168951712 20:1806653-1806675 ATCCCAGGGCTTCTCCAGGTGGG + Intergenic
1170942780 20:20863022-20863044 AGCCCAGAGCTGGTCCAGTAGGG - Intergenic
1172123083 20:32609835-32609857 AGAGCAGGGCTGCTTGAGACAGG - Intergenic
1172221118 20:33275895-33275917 AGCCCAGGGCAGGGCCAGAGAGG - Intronic
1172869431 20:38126592-38126614 GGGGCAGGGCTGCTCCAGCCAGG - Intronic
1173328240 20:42052770-42052792 AGTCCAGGGCTCCTGCAGGCTGG + Intergenic
1174114945 20:48220437-48220459 CGTCCAGGGCTGCTCCCTACAGG - Intergenic
1174165713 20:48582195-48582217 TGCCCAGGGCTGCTCCCCACAGG + Intergenic
1174237295 20:49104427-49104449 AGAGCTGGGCTGCTCCAGTCTGG - Intergenic
1175221917 20:57422150-57422172 TTCCCAGGGCAGCTCCAGGCAGG - Intergenic
1175778743 20:61669014-61669036 AGCTCAGGGCTGCGGCAGGCCGG + Intronic
1178133643 21:29601537-29601559 AGCCCAGGCCTGTTCCAGCTGGG - Intronic
1178874576 21:36403841-36403863 AGCCCAGGGTTGGGCCAAACGGG + Intronic
1179815476 21:43903517-43903539 AGCCCAGGGCTGCGGCTGGCAGG + Intronic
1180085032 21:45504610-45504632 AGCCGAGGGCAGGTCCAGCCCGG + Intronic
1180147403 21:45929014-45929036 AGCCCAGGGCTGCTCAGCAGAGG - Intronic
1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG + Intronic
1180500469 22:15924709-15924731 AGGCCAGGGCTGGTACAGAGGGG + Intergenic
1180674982 22:17580872-17580894 GGCCCAGGTCTGGTCCAGACAGG - Intronic
1180785300 22:18543797-18543819 AGCCCAGGGCCCCTCCTGCCTGG + Intergenic
1181128882 22:20717838-20717860 AGCCCAGGGCCCCTCCTGCCTGG + Intronic
1181242202 22:21483150-21483172 AGCCCAGGGCCCCTCCTGCCTGG + Intergenic
1181306733 22:21921359-21921381 TGGGCAGGGCTGCTCCAGGCAGG - Exonic
1181694573 22:24586481-24586503 AGGCCTGGGCTGTTCCCGACAGG - Intronic
1181734456 22:24870737-24870759 AGCTGAGGGCTGCTCCAGGGAGG - Intronic
1181895185 22:26100928-26100950 AGCCCAGTTCTGCTCGAGTCAGG - Intergenic
1182621179 22:31619620-31619642 AGCCCAGGGCTTCCCCAAAGCGG + Exonic
1182742319 22:32577006-32577028 AGCCCAGGGCTTGTCCACACTGG + Intronic
1183314385 22:37128955-37128977 GGCCCAGGGCTGCCCCATCCAGG + Intronic
1183512587 22:38244800-38244822 TGCCCAGGTCTGCCCTAGACAGG - Intronic
1183628665 22:39020419-39020441 CGCGCAGGGAGGCTCCAGACAGG + Intronic
1183632143 22:39040178-39040200 CGCGCAGGGAGGCTCCAGACAGG + Intergenic
1183637963 22:39076579-39076601 CGCGCAGGGAGGCTCCAGACAGG + Intronic
1183714202 22:39524208-39524230 AACCCAGGACGGCTCCAGTCTGG + Intergenic
1183928441 22:41222366-41222388 AGCCCAGAGGCGCCCCAGACTGG - Intronic
1184491818 22:44814287-44814309 AGCCCAGGTCAGCTCCTGGCAGG + Intronic
1184559389 22:45253147-45253169 AGTCCAGGGATGGTCCAGTCAGG + Intergenic
1185359883 22:50399678-50399700 AGCCAGGGGCTGCTCCAGGGAGG + Intronic
952566856 3:34669286-34669308 GGCCCAGGGCAGGTCCAGAAAGG - Intergenic
952965650 3:38619502-38619524 AGCTCAGGGCTGCTCATGTCTGG + Intronic
953007033 3:38988262-38988284 AGCCCTGGGCTGAGCCACACAGG + Intergenic
953706340 3:45233870-45233892 AGGCCAGGGCTGGTGCAGCCTGG - Intergenic
954274129 3:49531566-49531588 AGACCATGGCTCCTCCAGTCAGG + Exonic
954640943 3:52097366-52097388 ACCCCTGGGCTGCTTCAGATAGG + Intronic
955405068 3:58620762-58620784 TGCCCAGGGCTGCTTCAAACAGG - Intronic
956252534 3:67249808-67249830 AGCCTAAGGCTGTTCCAGAAGGG + Intergenic
956361193 3:68449662-68449684 AGCCCATGTCTGCTCCAAATGGG - Intronic
959477279 3:106826371-106826393 AGCCCAGAGCTTTTCAAGACAGG + Intergenic
959857673 3:111178658-111178680 AGACCAGTGATGCTCAAGACTGG - Intronic
961142532 3:124567319-124567341 AGCCCTGGTCTGCTCCAGCTTGG - Intronic
961324775 3:126103617-126103639 AGCCAAGGGCTGCTTCTGACTGG + Exonic
961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG + Intronic
963483290 3:145904034-145904056 AGCCCAGGGCTGTCACAGCCTGG + Intergenic
964891393 3:161540325-161540347 AGCCCAGGGCTGCCCCTGCCTGG - Intergenic
966408662 3:179626293-179626315 AGCCCAGATCACCTCCAGACTGG - Intronic
968650186 4:1757335-1757357 CCCCCAGGGCTGCTCCAGGCAGG + Intergenic
969089842 4:4685467-4685489 AGCCCAGGCTGGCTCCAGATGGG - Intergenic
972278689 4:37583298-37583320 AGCCCAGGAGTTCTCCAGCCAGG - Intronic
975712596 4:77175248-77175270 AGCCCTGAGCTTTTCCAGACAGG - Intronic
980322836 4:131302122-131302144 AGCCCAGGGCAGCTACAGCTTGG + Intergenic
984832872 4:183991916-183991938 AGCCCAGTTCTGCTCCTCACTGG - Intronic
985275112 4:188230849-188230871 AGATCAGGGCTGCTGCAGGCTGG + Intergenic
985329699 4:188817699-188817721 ATCCCATGGCTTCTCCAGAATGG - Intergenic
985824485 5:2182135-2182157 TGGGCAGGGCTGCTCCACACAGG - Intergenic
986418163 5:7549307-7549329 AGCCCAGCAATGCTCCAGATGGG - Intronic
987249346 5:16082461-16082483 AGCCCAGGGCTCCTCCACTTGGG + Intronic
989506432 5:42231281-42231303 AGCGCAGTGCTGCTACTGACTGG + Intergenic
989957345 5:50372856-50372878 ATCCCAGGGGGGCTCCATACTGG - Intergenic
993464263 5:88225399-88225421 ACCCCTGGGCTGCTCAAGGCCGG + Intronic
994174165 5:96692694-96692716 GGCTCAGGGTTGCTTCAGACAGG - Intronic
994353913 5:98774185-98774207 AGCCTCGGGCTGCTCCACGCAGG + Exonic
997328724 5:133043760-133043782 AGCCCAGCTCTGCTCTAGCCTGG - Intergenic
999244648 5:150147420-150147442 AGCCCATGGCTGCTCCGGGCTGG - Intronic
999458945 5:151741118-151741140 GACCCAGGGCTGCTGGAGACTGG - Intergenic
1000954814 5:167530672-167530694 AGCACAGGGCTCCACCTGACTGG - Intronic
1001354681 5:171007928-171007950 AGCCCAGGGTTGCTCCCCACCGG - Intronic
1001940671 5:175737372-175737394 AGCCCAAGGCTGCTGCTGAAGGG + Intergenic
1003159648 6:3624355-3624377 AGCCCACGGCCTCCCCAGACTGG + Intergenic
1003328341 6:5109593-5109615 ATCCCAGGGCTGCTCCCTTCCGG + Intronic
1004119968 6:12811712-12811734 AGACCAGAGCTGCTTCAGAAAGG - Intronic
1005242577 6:23849063-23849085 AGCCCAGGGGAGCAGCAGACTGG + Intergenic
1005521224 6:26602239-26602261 AGCCCAGGTCAGCCACAGACTGG - Intergenic
1006502433 6:34467026-34467048 AGCCCAGGTCTGCACCACATAGG + Intronic
1006531912 6:34662862-34662884 AGCCCAAGACTGGTCCAGCCTGG + Intronic
1007280984 6:40712303-40712325 GGCCCAGGGCTGCCCCATGCTGG + Intergenic
1007421125 6:41720380-41720402 AGGCCAGGGGCTCTCCAGACAGG + Intronic
1008940536 6:57041076-57041098 AGCCCAGGGCAGGTCCATCCTGG - Intergenic
1010285315 6:74070361-74070383 AGCCCAGTGGTTCTTCAGACAGG - Intergenic
1012140175 6:95616699-95616721 AGCCCAGGAGAGCTGCAGACAGG + Intergenic
1012250068 6:96970179-96970201 AGTCCAGGTCTGCTCTAGTCTGG + Intronic
1012903663 6:105038264-105038286 AGCCCAGTGCTTCTGAAGACTGG - Intronic
1017054417 6:150424642-150424664 AGTCCAGGGCTGTTACAGCCTGG + Intergenic
1018866550 6:167751033-167751055 AGCCCTGGCCAGCACCAGACTGG - Intergenic
1019480681 7:1265330-1265352 AGCCCTGGGCACCTCCATACTGG - Intergenic
1021910812 7:25384640-25384662 AGCACAGGGGTGCTCCAAGCAGG - Intergenic
1023116096 7:36864176-36864198 AGCCCAGATGTGCTCCGGACAGG + Intronic
1026930542 7:74220819-74220841 AGCCCAGGGCTGTGGCAGGCAGG - Intronic
1030208378 7:106972681-106972703 CGCCCATTGCTGCTCCAGATCGG - Intergenic
1032795068 7:135270211-135270233 AACCCCGAGATGCTCCAGACAGG - Intergenic
1032837367 7:135686582-135686604 AGCCCAGGTCTGTTTGAGACAGG - Intronic
1034391545 7:150791475-150791497 GGCCCTGGGCTGCCCTAGACAGG + Exonic
1034427987 7:151024425-151024447 AGGCCACGGCTTCTCCAGAAAGG + Exonic
1035224444 7:157425630-157425652 TTCCCAGGGCTGCTCCTGTCTGG + Intergenic
1035719421 8:1780559-1780581 AGGCCATAGCTGCTCCAGCCGGG + Exonic
1037731129 8:21524756-21524778 AGGCCAGGCATGGTCCAGACTGG - Intergenic
1037880857 8:22572757-22572779 CCCCCAGGGCTGCTCGAGGCAGG - Intronic
1037930896 8:22879676-22879698 TGCCCAGGGGTGCTTCACACCGG + Intronic
1039374103 8:37015919-37015941 AGCCCAGAGAAGCTCCAGAATGG + Intergenic
1040294489 8:46142175-46142197 CCCCCAGGGCTGCCCCAGATGGG - Intergenic
1040302702 8:46196173-46196195 CACCCAGGGCTGTTCCACACAGG + Intergenic
1040307341 8:46218981-46219003 CCCCCAGGGCTGTCCCAGACTGG - Intergenic
1040339911 8:46435243-46435265 ACCCCAGGGCTGTTCCTGGCAGG - Intergenic
1040661596 8:49582293-49582315 AGCCCAGAGCTTCTGCAGTCTGG + Intergenic
1041097931 8:54368029-54368051 AGCCTCGGGCTGATCCAGACCGG + Intergenic
1045297375 8:100883831-100883853 TGCTCAAGGCTGCTCCACACCGG + Intergenic
1046055267 8:109071240-109071262 AGCCCAGGCCAGCCCCAGAGAGG + Intergenic
1048300093 8:133245066-133245088 AGCCCAGGGCGCCTCAAGTCTGG + Intronic
1049360444 8:142210277-142210299 AGCCTCCTGCTGCTCCAGACAGG + Intergenic
1049369521 8:142257228-142257250 AACCCCGGGCTGCTCCAGTTGGG - Intronic
1049406037 8:142452254-142452276 AGCCCAGGGATGCGCCAGAGAGG + Intronic
1049604201 8:143521481-143521503 GGCCCGGAGCTGCTCCAGCCTGG - Intronic
1049604523 8:143523091-143523113 TGCCCAGAGGTGCCCCAGACTGG + Intronic
1049636874 8:143693812-143693834 TTCCCAGAGCTGCTCCAGAAAGG + Exonic
1049659004 8:143811431-143811453 ACCCCAGGCCAGCTCCAGCCAGG + Intronic
1049800813 8:144516746-144516768 GGCCCAGGGCTGGTCCGGCCTGG + Exonic
1049841889 8:144778187-144778209 AGCCCAGGTGTGGTCCAGAGTGG + Intronic
1052297550 9:26914867-26914889 AACCCAGGGTTACTCCAAACTGG + Intronic
1052732905 9:32310760-32310782 GGCCCAGGGCAGGTCCAGAAAGG - Intergenic
1053437995 9:38089997-38090019 GGCCCAGAGCTGCTACAGGCTGG - Intergenic
1056802409 9:89701684-89701706 AGCTCAGGGCTGCTCCGTATGGG + Intergenic
1056843274 9:90016064-90016086 AGCCGAGGGCTGCTCCCGCAGGG + Intergenic
1061359752 9:130133567-130133589 TGCACAGGGCTGCTCCTGAAGGG - Intronic
1061489553 9:130937719-130937741 GCCCCAGGGCTGCCCCAGGCTGG - Intronic
1061547868 9:131315193-131315215 AGCCCAGCCCAGCTCCAGCCTGG - Intergenic
1062511176 9:136907037-136907059 AGCCCACTGCTGCCCCAGGCAGG - Intronic
1190008230 X:46759552-46759574 GGCCCAGGGCGGCTGCACACTGG - Intergenic
1193360440 X:80573613-80573635 AGCCCAGAGCTTCTCAACACCGG - Intergenic
1194671022 X:96732955-96732977 AGCCCAGGGCTGAATCATACAGG + Intronic
1196430118 X:115615601-115615623 CTCCCAGTGCTGCACCAGACAGG - Intronic
1198618106 X:138480366-138480388 AGCCCTGCGATGCTGCAGACAGG + Intergenic
1200079238 X:153567423-153567445 AGCCCAGAGCTGCCCAAGCCTGG + Intronic
1200096978 X:153669101-153669123 AGCCCAGGTCTACCCCAGCCTGG + Intergenic
1200099760 X:153684729-153684751 AGCCTAGGGCAGCTGCGGACCGG - Intronic
1201158138 Y:11150816-11150838 AGCCCATGGCTGTTACTGACCGG - Intergenic