ID: 1157711518

View in Genome Browser
Species Human (GRCh38)
Location 18:49852970-49852992
Sequence GTCACCAAAGGAGCCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157711518_1157711520 -9 Left 1157711518 18:49852970-49852992 CCTGCTGGGGCTCCTTTGGTGAC 0: 1
1: 0
2: 0
3: 16
4: 173
Right 1157711520 18:49852984-49853006 TTTGGTGACTGTCTGCAAAGAGG 0: 1
1: 0
2: 2
3: 16
4: 215
1157711518_1157711525 29 Left 1157711518 18:49852970-49852992 CCTGCTGGGGCTCCTTTGGTGAC 0: 1
1: 0
2: 0
3: 16
4: 173
Right 1157711525 18:49853022-49853044 CCACTACTCCTCCCCTCAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157711518 Original CRISPR GTCACCAAAGGAGCCCCAGC AGG (reversed) Intronic
900113859 1:1020473-1020495 GTCGCCAAGGGAGCCGGAGCGGG - Intronic
900497156 1:2980946-2980968 GTCACCTGAGGAGCACCCGCTGG - Intergenic
901222681 1:7592523-7592545 GTCATCAGAGGACCCCCAGAGGG - Intronic
902923811 1:19682814-19682836 GTCCCCAGAGGAGCCCCACCAGG - Exonic
903140060 1:21334024-21334046 CTCACCAAAGGTCACCCAGCTGG + Intronic
903190743 1:21654166-21654188 GTCACCAAAGGACCAGGAGCTGG - Intronic
903495018 1:23760121-23760143 GTCCCCAAGGGAGCCTCAGTGGG + Exonic
903890894 1:26569816-26569838 GTTACCGAAGGAGCCCCTGGTGG + Intronic
905028426 1:34866256-34866278 GATACCAAAGAAGCCCCTGCGGG - Exonic
906661708 1:47587567-47587589 GTCACCATAGAAGCCCCTCCAGG - Intergenic
910218175 1:84863500-84863522 GCCAGCAAAGGAGCCCTAGAAGG - Intronic
912650575 1:111435255-111435277 GTGGCCTAAGGAGCCCCAGATGG - Intergenic
913118086 1:115714861-115714883 TTCCCCAAAAGAGCCCAAGCTGG - Intronic
914792455 1:150890407-150890429 GTCACACAAGGAGCTCAAGCAGG + Intergenic
919784591 1:201251222-201251244 GACAACGAAGGAGACCCAGCGGG - Intergenic
922499488 1:226085963-226085985 GTCCCCCAAGGAGCCACAGTGGG + Intergenic
923236460 1:232038305-232038327 GTCTCAATAGGAGTCCCAGCTGG - Intronic
923565089 1:235070434-235070456 GCCACCAAAGGCCCCACAGCAGG + Intergenic
924719346 1:246607701-246607723 GTCACCAAGGTAGCCGAAGCAGG - Intronic
1065751419 10:28891028-28891050 GTGCCCAAAGGAGACCCAGATGG - Intergenic
1065772685 10:29092335-29092357 GAAACCAAAAGAGCCCCAGAGGG + Intergenic
1066307981 10:34165697-34165719 GTCAACAAAGGAGAGCCAGCAGG - Intronic
1069513074 10:69056583-69056605 GGCTCTAAAGGAGCGCCAGCAGG - Intergenic
1070346576 10:75548557-75548579 TTCAGCACAGGAGCCCCAGATGG + Intronic
1072513394 10:96151512-96151534 GTCACCCAAAGGGCTCCAGCTGG + Exonic
1072535416 10:96359210-96359232 CTCAGCAAAGAAGCCACAGCTGG + Exonic
1074700125 10:116085422-116085444 GTTACCAATGGATCCCAAGCTGG + Intronic
1076229268 10:128806641-128806663 GTCAACATAGCAGCTCCAGCAGG - Intergenic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077258054 11:1598002-1598024 GCCCCCACAGGAGCCACAGCTGG + Exonic
1077259483 11:1608200-1608222 GCCCCCACAGGAGCCACAGCTGG + Exonic
1077261196 11:1621866-1621888 GCCCCCACAGGAGCCACAGCTGG + Exonic
1077284820 11:1760959-1760981 GTCACCACAGGCCTCCCAGCAGG + Intronic
1080251006 11:30233766-30233788 TTCACCAAAGGAGCAGTAGCTGG - Exonic
1084798789 11:71527464-71527486 GCCCCCACAGGAGCCACAGCTGG - Exonic
1084800120 11:71538198-71538220 GCCCCCACAGGAGCCACAGCTGG - Exonic
1084803893 11:71565772-71565794 GCCCCCACAGGAGCCACAGCTGG - Exonic
1084806473 11:71582652-71582674 GCCCCCACAGGAGCCACAGCTGG + Exonic
1089589281 11:119530186-119530208 GTCACCAATGCATCCCCAGAAGG - Intergenic
1091644208 12:2261550-2261572 GTGTCCCAAGGAACCCCAGCAGG - Intronic
1092249298 12:6883791-6883813 GTCACCAACGGAGCCATAGAGGG + Intronic
1095788921 12:46143227-46143249 CTCCCCAAAGCAGCCACAGCTGG + Intergenic
1097021450 12:56023488-56023510 CTCACCTAAAAAGCCCCAGCTGG + Intronic
1097337057 12:58395064-58395086 GTCACCACAGGTGCCACAGGTGG - Intergenic
1097790886 12:63814333-63814355 GTTGCCAAAGCAGCCACAGCAGG + Intergenic
1100168382 12:91944620-91944642 GACACTAAAGGACCCCCACCAGG + Intergenic
1102219960 12:111187661-111187683 GGCACCTCAGGAGACCCAGCCGG - Intronic
1103933782 12:124464643-124464665 GGCACCAAAGAAGTGCCAGCTGG - Intronic
1104799302 12:131542723-131542745 GTCACCAAAGCAGCCCTGGTAGG - Intergenic
1106343616 13:28854918-28854940 GTCACCAGAGCATCCCCAGGAGG - Intronic
1114741328 14:25100857-25100879 TTCACCAAAGGAGACACAGATGG + Intergenic
1115556253 14:34547019-34547041 GTTACTAAAGGATCCCCCGCGGG - Intergenic
1115557655 14:34556062-34556084 GTTACTAAAGGATCCCCCGCGGG + Intergenic
1118381084 14:65217859-65217881 GTCACCATTGGAGAACCAGCAGG + Intergenic
1120174504 14:81278600-81278622 GTCATCAAAGGTGACCCAGCTGG + Exonic
1121622914 14:95362634-95362656 GTCACGAACGGGGCCCCAGTGGG - Intergenic
1121881324 14:97502972-97502994 GTCACTAAAGGGTCCCCACCAGG + Intergenic
1125760757 15:42094100-42094122 GTCACAAAAGGAGACCCACCAGG - Intronic
1126175698 15:45733307-45733329 GTGGGCAAAGGGGCCCCAGCTGG + Intergenic
1128312862 15:66642274-66642296 GTCACAGAAGGAGCCCTAGGCGG - Intronic
1128605261 15:69032226-69032248 GTCTGGAATGGAGCCCCAGCAGG - Intronic
1129152100 15:73695836-73695858 GTTGCCCAAGGAGCCCCTGCGGG + Intronic
1129444644 15:75608428-75608450 ACCACCAAAGGAGCCTGAGCAGG + Intronic
1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG + Intergenic
1132973175 16:2698772-2698794 GGCACCAAGGGAGCTCCAGCAGG - Intronic
1133907174 16:10033007-10033029 GATACCACAGGTGCCCCAGCTGG + Intronic
1134466445 16:14482911-14482933 GTGGTCAAAGGAGCCCCATCAGG + Intronic
1135929685 16:26726005-26726027 GATAGCACAGGAGCCCCAGCAGG - Intergenic
1136102125 16:28004038-28004060 GTCAGCCCAGCAGCCCCAGCAGG - Intronic
1136297938 16:29314261-29314283 GTCTCCAAAGCAGAGCCAGCCGG - Intergenic
1137254161 16:46761242-46761264 GACATCAATGGAGGCCCAGCAGG + Intronic
1137340610 16:47599969-47599991 TTCATTAAAGGAGCCTCAGCTGG + Intronic
1137341870 16:47615335-47615357 ATCAACAAAGAAGCCCCAGACGG - Intronic
1138219799 16:55240986-55241008 CTCAACAAAGAAGTCCCAGCAGG - Intergenic
1139441757 16:66971553-66971575 CTCACCAAAGGTCACCCAGCAGG + Intronic
1141695852 16:85619086-85619108 GTCACCACAGCAGACCCTGCCGG + Intronic
1141797971 16:86287285-86287307 GGCACCAGAGGGGCCCCGGCAGG - Intergenic
1142259947 16:89038007-89038029 TTCCCCAAAGCAGCCCCAGCGGG + Intergenic
1147241930 17:39096201-39096223 ATCACGAGTGGAGCCCCAGCAGG + Intronic
1148567637 17:48642910-48642932 GTCCCCCCAGGAGCCGCAGCGGG + Intergenic
1148849456 17:50547746-50547768 GGCCCCACAGGAGTCCCAGCAGG + Exonic
1150424629 17:65067507-65067529 GTGACAACAGGAGCCTCAGCAGG - Intergenic
1151662586 17:75526364-75526386 GTGTCCAAAGCCGCCCCAGCTGG - Intronic
1151806001 17:76405775-76405797 GTGACCACAGGGGCCCCAGGAGG - Intronic
1152291027 17:79440437-79440459 ATAGCCAATGGAGCCCCAGCTGG - Intronic
1152751053 17:82062570-82062592 ATCCCCAAAGGAGGCCCTGCCGG + Intronic
1153348567 18:4054220-4054242 GTCACCATGGGAGCCCCATGAGG + Intronic
1157428922 18:47607278-47607300 CTCACCCAAGGATCCACAGCTGG - Intergenic
1157711518 18:49852970-49852992 GTCACCAAAGGAGCCCCAGCAGG - Intronic
1159220172 18:65450738-65450760 GTCACATAAGTAGCCCCAGGTGG + Intergenic
1160756257 19:758482-758504 GGCCCCAGACGAGCCCCAGCAGG + Exonic
1161073001 19:2271548-2271570 GGCCCCAGAGCAGCCCCAGCAGG - Intronic
1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG + Exonic
1164986097 19:32649858-32649880 GTCCCCAAAGGCGCTCCAGCTGG + Intronic
1165426212 19:35746789-35746811 GTCCCCAAGGGCACCCCAGCGGG - Exonic
925182212 2:1824610-1824632 CTCCCCAAAGGAGCCGCAGAGGG - Intronic
927512145 2:23650485-23650507 GTCAGCTAAGTAGCCCGAGCAGG - Intronic
927739129 2:25551467-25551489 TTCAGCCAAGGATCCCCAGCCGG - Intronic
934717367 2:96551668-96551690 GTCAGTGAAAGAGCCCCAGCTGG + Exonic
938257130 2:129868257-129868279 GTGACCACAGGAGCAGCAGCAGG + Intergenic
942688959 2:178564887-178564909 GTCACAAAAGGAGTTCCAGGTGG + Exonic
945035202 2:205698451-205698473 GTCACCCAAGGTGACTCAGCTGG + Intronic
945478441 2:210315396-210315418 GTCACCAAAGGATCTGAAGCTGG - Intergenic
946758361 2:222969110-222969132 GTCTCCCAAGAGGCCCCAGCAGG - Intergenic
947753058 2:232542769-232542791 GTGCCCTAAGGAGCACCAGCAGG - Intronic
948642709 2:239385667-239385689 GCCACCCCAGGAGCCCCAGAAGG + Intronic
948845788 2:240682248-240682270 GTGACCAACAGAGCCACAGCGGG + Exonic
948848069 2:240692482-240692504 GTGACCAACAGAGCCACAGCGGG - Exonic
1169849909 20:10036952-10036974 GTCAGCAAAGGAGCCTGAGCAGG + Intronic
1170159269 20:13295883-13295905 GTCAGCAAAGCATCCACAGCAGG + Intronic
1172039854 20:32036199-32036221 GTGAACAAAGGTGCCCCACCTGG + Intergenic
1172164631 20:32891663-32891685 GTCACAAAAGGAGCACTGGCTGG - Intronic
1173464434 20:43269727-43269749 GTCAGCAAGGGAGCCCGAGAAGG + Intergenic
1174481810 20:50836569-50836591 GTCACCCCAGGACCCCCGGCTGG - Intronic
1175199597 20:57268051-57268073 GTCCCCAAGGGAGACCCAGAGGG - Intergenic
1175624072 20:60475877-60475899 GGCACCCTAGGAGCCCCTGCAGG + Intergenic
1176109967 20:63406671-63406693 GTCACCAAAGGGACCCTCGCCGG + Exonic
1181574365 22:23784321-23784343 TTCACAAAAGGAGACCAAGCAGG - Intergenic
1181647767 22:24243065-24243087 GTCACTCAGGGAGACCCAGCAGG + Intronic
1182022385 22:27091696-27091718 GTCACCTACTGAGCCCCATCAGG + Intergenic
1182134025 22:27883835-27883857 GTCTCCAAAGGAGACCAAACTGG + Intronic
1183586314 22:38755283-38755305 GTCACCAAAGGCGCGCCTCCTGG + Intronic
1184691150 22:46117897-46117919 GTCACCAATGCAGCACCAGAGGG - Intergenic
950664515 3:14487146-14487168 TTCACCCAGGGAGCCCCCGCTGG - Exonic
951843657 3:27062340-27062362 GACAGCAAAGGAGTCCCAGCTGG - Intergenic
952336417 3:32407071-32407093 GGCACCAAGGGAGTCCCTGCTGG + Intronic
958136833 3:89504624-89504646 GTCCCCCAAGGAGACCCAGGTGG - Intergenic
960412539 3:117345582-117345604 GTCAACTGAGGAGCCCCAGGAGG + Intergenic
960420920 3:117444412-117444434 GTGACCACTGGAGCCCCAGAGGG + Intergenic
961355770 3:126339114-126339136 GACCCCAAAGGAGCCCCTCCTGG - Intergenic
961447057 3:126985783-126985805 GTCACCCAACTAGTCCCAGCAGG - Intergenic
961453172 3:127011690-127011712 GAGACCAAAGGAGCCCCATCTGG - Intronic
963010063 3:140760457-140760479 ATAAGCCAAGGAGCCCCAGCAGG + Intergenic
966442820 3:179965322-179965344 CTGACCAAAGGAGGCCAAGCTGG + Intronic
969267146 4:6071854-6071876 TTTACCAAAGGGCCCCCAGCAGG + Intronic
969583190 4:8077264-8077286 GTCCCCATAGGAGGCACAGCGGG - Intronic
974164599 4:58185305-58185327 GTCACCCCTGGAGGCCCAGCTGG - Intergenic
975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG + Exonic
975512932 4:75213117-75213139 GTCACCAAAAGAGCCTGAGAAGG + Intergenic
978633915 4:110780857-110780879 GTCTCCACAGGAGCCTTAGCAGG - Intergenic
981563046 4:146067731-146067753 GAAACCAAAGGAGCAACAGCAGG - Intergenic
985718044 5:1473643-1473665 GTCTCCAAGGGACCCCCTGCAGG - Intronic
988635430 5:32978386-32978408 GTGACCCACGGAGCCCCAGAGGG - Intergenic
989985078 5:50687781-50687803 GTCACGAAAGCAGCACCAGAAGG + Intronic
998680233 5:144459015-144459037 GTCAATCAAGTAGCCCCAGCAGG + Intronic
1002964189 6:1946261-1946283 GCCACCAAAGGAGCCGCACAAGG + Intronic
1003453976 6:6263467-6263489 GTCAACAAAGGAGGCTGAGCAGG - Intronic
1004011158 6:11689036-11689058 GTCTCCAAAAGAGACCAAGCAGG - Intergenic
1005473976 6:26189258-26189280 GGCAACAAAAGAGCCTCAGCTGG + Intergenic
1005999837 6:30956203-30956225 GACACCAAGGCAGCCCCACCTGG + Intergenic
1006804155 6:36777601-36777623 CTCACCAAAGGACTCCCAGAAGG - Intronic
1007423193 6:41731927-41731949 GTGACCAAAGGACCTCCGGCTGG - Intronic
1008953180 6:57183026-57183048 GGCACCAAAGGAGCCCAAGTAGG - Intronic
1010099661 6:72089315-72089337 GCCACCACAAGAGCCACAGCAGG - Intronic
1015880292 6:137865375-137865397 GTTTACAAAGGAGCACCAGCAGG + Intergenic
1016259161 6:142147141-142147163 GTCAACTACGGATCCCCAGCTGG - Intronic
1016319266 6:142824598-142824620 GTCACCAAAGCAGTTCCATCAGG + Intronic
1018057500 6:160065073-160065095 GTCACCACAGCAGCTCCAGGTGG - Intronic
1018905831 6:168075396-168075418 CTCAGCAAACGAGGCCCAGCGGG + Intronic
1019478099 7:1253819-1253841 GTCACAGAAGGGGCCCAAGCTGG - Intergenic
1019597948 7:1867034-1867056 GTCACCACAGCAGCACCTGCTGG + Intronic
1019654471 7:2182823-2182845 GTCCCCAAAGGAAGCCCAGTTGG - Intronic
1022497431 7:30861856-30861878 GTCACCACAGAAGCCCCATCAGG - Intronic
1024522099 7:50314740-50314762 GCCTCCACAGGAGCCCCAGCAGG + Intronic
1024632646 7:51262306-51262328 CTCTTCAAAGGAGCCCCAGGAGG + Intronic
1027196307 7:76032934-76032956 GTCATCAAAGGAGCCACACCAGG - Intronic
1030797737 7:113809661-113809683 GTCAGCAAATGAGGTCCAGCAGG + Intergenic
1032086815 7:128888812-128888834 GGCACCCCGGGAGCCCCAGCAGG + Intronic
1032364511 7:131286803-131286825 GTCCCAAAAGGAGCCCCAATGGG + Intronic
1033062502 7:138122248-138122270 GTAACCACAGGGGCCCCAGGCGG + Intergenic
1033635678 7:143209527-143209549 GTTCCCAAAGAAGCCCCAGTGGG + Intergenic
1034941921 7:155236349-155236371 GTCACCACAGGAGCCACACTTGG - Intergenic
1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG + Intronic
1035636206 8:1146161-1146183 CTCTCCACAGGAGCCCCTGCAGG + Intergenic
1036769019 8:11566081-11566103 CACCCCACAGGAGCCCCAGCAGG - Intergenic
1039424900 8:37477643-37477665 CTCAGAAAAGGAACCCCAGCTGG - Intergenic
1039573296 8:38603845-38603867 TTCACCAAAGCAGCCCCAAGGGG + Intergenic
1042867113 8:73365844-73365866 GTGATCAAAGCAGACCCAGCAGG + Intergenic
1048951725 8:139502042-139502064 GTCCCCAAAGCAGCCTCAGCTGG - Intergenic
1055578914 9:77687907-77687929 GTAAACAAAGCAGCCGCAGCCGG - Intergenic
1057790047 9:98118848-98118870 GAAACCAAAGGTGCCCCAGAGGG - Intronic
1058721489 9:107768539-107768561 GTGACCAGAGAAGCCCCAGGGGG + Intergenic
1185860405 X:3573434-3573456 GCTTCCAAAGGAGCCTCAGCAGG - Intergenic
1187112121 X:16312878-16312900 GGGGCCACAGGAGCCCCAGCAGG + Intergenic
1188261944 X:28033402-28033424 GTCACCAAAAGGGCCCCAAAAGG + Intergenic
1188262465 X:28036702-28036724 GTCACCAAAAGGGCCCCAAAAGG - Intergenic
1191052925 X:56213723-56213745 GTCACCCCAGAAGCCCCAGAAGG + Intergenic
1198222277 X:134613496-134613518 TTCACCAAAGGAGTCACAGAGGG - Intronic
1199609534 X:149600928-149600950 GTTGCCAAAGTACCCCCAGCAGG - Intronic
1199629582 X:149768426-149768448 GTTGCCAAAGTACCCCCAGCAGG + Intergenic