ID: 1157712953

View in Genome Browser
Species Human (GRCh38)
Location 18:49862659-49862681
Sequence CTCGAAAATAAGCTGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157712953_1157712960 8 Left 1157712953 18:49862659-49862681 CCCTGGCTCAGCTTATTTTCGAG 0: 1
1: 0
2: 1
3: 2
4: 80
Right 1157712960 18:49862690-49862712 GGTTGCTAAACTCACATCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 73
1157712953_1157712959 7 Left 1157712953 18:49862659-49862681 CCCTGGCTCAGCTTATTTTCGAG 0: 1
1: 0
2: 1
3: 2
4: 80
Right 1157712959 18:49862689-49862711 TGGTTGCTAAACTCACATCCAGG 0: 1
1: 0
2: 1
3: 8
4: 101
1157712953_1157712961 22 Left 1157712953 18:49862659-49862681 CCCTGGCTCAGCTTATTTTCGAG 0: 1
1: 0
2: 1
3: 2
4: 80
Right 1157712961 18:49862704-49862726 CATCCAGGGAGATCTCATTTTGG 0: 1
1: 0
2: 0
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157712953 Original CRISPR CTCGAAAATAAGCTGAGCCA GGG (reversed) Intronic
910812518 1:91253070-91253092 CAAGGAAATAAGCTGACCCATGG + Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
922434108 1:225586121-225586143 CTGGAGGATCAGCTGAGCCAAGG + Intronic
923032302 1:230258978-230259000 TTGGAAAAGAAGCTGATCCAGGG + Intronic
1064678580 10:17786510-17786532 CAAGAACATCAGCTGAGCCAGGG - Intronic
1065163942 10:22954909-22954931 CTGGAGAATAAGGAGAGCCAGGG + Intronic
1067773847 10:49147070-49147092 CTCAAAAAGAAGTTGAGCCTGGG - Intergenic
1071317142 10:84412829-84412851 CTGGAAGAGAAGCTGAGGCAGGG - Intronic
1077513154 11:2982571-2982593 CACGAAAAGAAGCTGAGGCTTGG + Intronic
1077868501 11:6241956-6241978 CCTGAGAAGAAGCTGAGCCAAGG + Intronic
1080074331 11:28130972-28130994 CTACAAAATAAACTGATCCAAGG - Intronic
1082007060 11:47425281-47425303 CTCTAGCATAAGCTGTGCCAGGG - Intronic
1085730672 11:78996008-78996030 CACGTAAATCAGCTGAGCAAAGG - Intronic
1095696182 12:45146753-45146775 CTTGAAAGTAGCCTGAGCCAGGG - Intergenic
1099624904 12:85059102-85059124 GTCAAAAAGAAACTGAGCCATGG - Intronic
1101169135 12:102070284-102070306 CACAGAAATAAGCTGATCCAAGG + Intergenic
1101407786 12:104443867-104443889 CACAAAAGAAAGCTGAGCCAAGG + Intergenic
1102165360 12:110801838-110801860 CTGGAAGATGAGCTGACCCAGGG - Intergenic
1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG + Intergenic
1108222792 13:48254371-48254393 CTGGAAAAGAAGCAGAGACATGG - Intronic
1112459505 13:99590732-99590754 CTAGCAAATAAACTGAGCCAGGG + Intergenic
1118889094 14:69892660-69892682 CTTCAAAATAATCTGAGCAAGGG - Intronic
1121858738 14:97296079-97296101 CTAGAAAAAAAGCTGAGGAATGG + Intergenic
1122433789 14:101677764-101677786 CTCGAAAACGAGCTGAGGGAAGG + Intergenic
1128440470 15:67703256-67703278 CACCAAAATAAGCTCAGCTAAGG - Intronic
1128492371 15:68161772-68161794 TACAAAAATTAGCTGAGCCATGG + Intronic
1138514667 16:57529369-57529391 CTCGAAGATCAGCCGCGCCAAGG + Intronic
1140285281 16:73597127-73597149 TTGGAAAAGAACCTGAGCCAGGG - Intergenic
1140965524 16:79962681-79962703 CTAGAACATAAGCTGAAACAAGG - Intergenic
1143668857 17:8382932-8382954 CTCGAAAACGAGCTGAGGGAAGG - Exonic
1143874300 17:9980154-9980176 CTAGAAAATCAGCTGAGGCGTGG - Intronic
1144863400 17:18319811-18319833 CACGAGAATAACCTGAGCCTAGG - Intronic
1154976492 18:21462359-21462381 TTCAAAAATAAGCAGAGGCAAGG - Intronic
1155474896 18:26227352-26227374 CTCCTAAAAAAACTGAGCCACGG + Intronic
1156203907 18:34865142-34865164 CTCGCAAATGAGCTGCCCCAGGG - Intronic
1157712953 18:49862659-49862681 CTCGAAAATAAGCTGAGCCAGGG - Intronic
1158062979 18:53369152-53369174 CTTCAAAATTAACTGAGCCAAGG - Intronic
1158187601 18:54788596-54788618 CTCAAAAGTCAGCTGAGCCCAGG - Intronic
1158447773 18:57536152-57536174 CTCAAAAATAAGTTTAACCAGGG + Intergenic
925139739 2:1541896-1541918 CTCGGAGATAAGCAGAGCCCAGG + Intronic
927274152 2:21247353-21247375 TTTGAAAATCAGGTGAGCCATGG - Intergenic
933297068 2:80502937-80502959 CTGGAAGATAAGTTGAGCCCAGG + Intronic
937515998 2:122656111-122656133 CAGGAAAACAAGCTAAGCCATGG - Intergenic
937995177 2:127689026-127689048 CTTGAAAATTAGCTGAGCATTGG + Intergenic
938790926 2:134675007-134675029 CTCGGAAATGAGCTTTGCCATGG - Intronic
938921176 2:135996484-135996506 CTCAAAACCAAGCTGAGCAAAGG - Intergenic
1172244298 20:33435144-33435166 TACAAAAATTAGCTGAGCCATGG - Intronic
1176661992 21:9645699-9645721 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1177008637 21:15704966-15704988 GTAGAAAATAAGATGAGACAGGG + Intergenic
1177396395 21:20540657-20540679 CTGGAACTTAGGCTGAGCCATGG - Intergenic
1182124912 22:27809338-27809360 CTGGAAGATAAGCTCAGCCTGGG - Intergenic
959429579 3:106236301-106236323 CATGAAAATCACCTGAGCCAGGG + Intergenic
964423428 3:156528825-156528847 CTAGAAAATAAGGTTTGCCAAGG + Intronic
965533768 3:169803026-169803048 CATGAAAATAAGATGGGCCAGGG - Intronic
969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG + Intergenic
973228141 4:47810020-47810042 CTTGAAACTAAGCTGAGCACAGG + Intronic
980215645 4:129849749-129849771 TACAAAAATAAGCTGGGCCATGG + Intergenic
982861755 4:160460622-160460644 CTCTAAAATAAAGTGAGGCACGG + Intergenic
983090138 4:163493645-163493667 CTGGAAAATGAGCTGAGTGAGGG + Intergenic
985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG + Intergenic
987755374 5:22094228-22094250 CTAGAAAATAAGCTGAGGCATGG - Intronic
992415392 5:76547856-76547878 CAGGAAAATAAGCTGACCAAAGG - Intronic
998139825 5:139693434-139693456 CTCGAGAATGAGCTGAGCTCAGG - Intergenic
1000019708 5:157308709-157308731 CTTGAAAACAAGCAAAGCCAAGG - Intronic
1003169271 6:3708308-3708330 ATTGAAAATCAGCAGAGCCAAGG - Intergenic
1003779662 6:9409945-9409967 CTCAATATTAAACTGAGCCAAGG - Intergenic
1007563183 6:42827582-42827604 CTCGAAAATACTCTGAGGCTGGG + Intronic
1014965114 6:127738638-127738660 CTTGAAAATAAGCAAAGTCAGGG - Intronic
1015569330 6:134604962-134604984 ATCTAAAAGAAGCTGAGCCTGGG - Intergenic
1016358992 6:143248127-143248149 CTCGAAAATAATATTATCCATGG + Intronic
1021997315 7:26192889-26192911 CTCAAAAATAAGCTAAGCAATGG + Intronic
1024078455 7:45836043-45836065 AACCAAAATAAGCTAAGCCATGG + Intergenic
1026233405 7:68505251-68505273 CTAGAATAGAAGCTGAGGCACGG - Intergenic
1027379316 7:77589026-77589048 TACAAAAATGAGCTGAGCCATGG - Intronic
1030643109 7:112027846-112027868 CAAGAAAAGAAGCTGAGACAAGG + Intronic
1034018455 7:147612916-147612938 GTGGAAAATAAGTTGAGCTATGG - Intronic
1039933179 8:42013531-42013553 ATTGAAAAAAAGCAGAGCCAAGG - Intronic
1041352754 8:56965224-56965246 CACGAAAATCACCTGAGCCCAGG + Intronic
1044541912 8:93417791-93417813 CTCAAAGATAATCTGATCCATGG - Intergenic
1047186449 8:122637410-122637432 CTCGATACTTAGATGAGCCAGGG + Intergenic
1203639553 Un_KI270750v1:147542-147564 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1185663392 X:1744901-1744923 CTTGAACATCAGCTGAGCAAAGG - Intergenic
1191090553 X:56616299-56616321 TTGGAAAAAAAGCTGAGGCAGGG - Intergenic
1193902214 X:87195030-87195052 CTTGGAAATAAACTTAGCCAAGG + Intergenic