ID: 1157715175

View in Genome Browser
Species Human (GRCh38)
Location 18:49880050-49880072
Sequence CAGTTTGTTCATCTACTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 825
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 749}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157715175_1157715176 -8 Left 1157715175 18:49880050-49880072 CCATGTAGTAGATGAACAAACTG 0: 1
1: 0
2: 4
3: 71
4: 749
Right 1157715176 18:49880065-49880087 ACAAACTGAAAGCCTATTCAAGG 0: 1
1: 1
2: 2
3: 20
4: 552
1157715175_1157715178 10 Left 1157715175 18:49880050-49880072 CCATGTAGTAGATGAACAAACTG 0: 1
1: 0
2: 4
3: 71
4: 749
Right 1157715178 18:49880083-49880105 CAAGGCCATACAGAAGCACACGG 0: 1
1: 0
2: 0
3: 25
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157715175 Original CRISPR CAGTTTGTTCATCTACTACA TGG (reversed) Intronic
900934187 1:5755067-5755089 CAGTTTGCTCATCTATAAAATGG + Intergenic
901699619 1:11038248-11038270 CAGTTTCTTCATCTGCAAGATGG + Intronic
902691475 1:18112504-18112526 CAGTTTCCTCATCTACAAAATGG - Intronic
902935686 1:19763033-19763055 CAGTTTCTTCATCTGCAAAAGGG + Intronic
903022231 1:20402338-20402360 CAGTTTTTTCATCTGCTAAATGG - Intergenic
903060458 1:20665105-20665127 CAGTTTCCTCATCTGCAACATGG + Intronic
903086690 1:20867144-20867166 CAGTTTTGTCATCTAAAACAAGG + Intronic
903190765 1:21654396-21654418 CAGTTTTTTCATCTGCAAGATGG + Intronic
903261287 1:22133013-22133035 CAGTTTGTTCATCTGTGAAATGG - Intronic
903343121 1:22667248-22667270 CAGTTTCTTCATCTGTCACATGG + Intergenic
903361896 1:22782192-22782214 CAGTTTCTTCATCTATAAAATGG + Intronic
903464779 1:23544570-23544592 CAGTTTCTTCATCTATAAAATGG - Intergenic
903569361 1:24293076-24293098 CAGTTTGCTCATCTGCCAAATGG + Intergenic
903604089 1:24562352-24562374 CAGTTTCTTCATCTGCAAGATGG - Intronic
903817498 1:26075486-26075508 CAGTTTCTTCATCTGCCAAATGG + Intergenic
903871750 1:26440452-26440474 CAGTTTCTTCATCTATAAAATGG + Intronic
904131457 1:28278750-28278772 CAGTTTCCTCATCTATAACATGG + Intronic
904315228 1:29655786-29655808 CAGTTTCTTCATCTGTTAAATGG + Intergenic
904426011 1:30423656-30423678 CAGTTTCTTCATCTATAAAATGG - Intergenic
904496388 1:30889166-30889188 CAGTTTCTTCACCTACTAAATGG + Intronic
904636555 1:31886013-31886035 CAGTTTCTTCATCTATAAAATGG - Intergenic
905121394 1:35684747-35684769 CAGTTTGTTCATCTGAAAAATGG - Intergenic
905260839 1:36717242-36717264 CAGTTTCTTCATCTATCAAATGG + Intergenic
905311271 1:37050862-37050884 CAGTTTCTTCATCTGCAAAATGG - Intergenic
905337332 1:37254172-37254194 CAGTTTCTTCATCTATAAAATGG + Intergenic
905474482 1:38216476-38216498 CAGTTTCCTCATCTGTTACATGG + Intergenic
905581178 1:39083352-39083374 CAGTTTCTTCATCTGCAAAATGG - Intronic
905852520 1:41284553-41284575 CAGTTTCCTCATCTACAAAATGG - Intergenic
905857631 1:41324557-41324579 CAGTTTCCTCATCTATAACAAGG + Intergenic
906075428 1:43048674-43048696 CAGTTTGCTCATCTATCAAATGG - Intergenic
906241320 1:44243986-44244008 CAGTTTCTTCATCTATAAAATGG + Intronic
906267867 1:44447993-44448015 CAGTTTATTAATATACTAAAGGG - Intronic
906420063 1:45658228-45658250 GTGATTGTTCAACTACTACATGG - Intronic
906657729 1:47560965-47560987 CAATTTGTTCATCTGTTAAATGG + Intergenic
906760297 1:48371134-48371156 CAGTTTATTCAAATAATACAAGG + Intronic
906982463 1:50646110-50646132 CAGTTTCTTTATCTACAAAATGG - Intronic
907321570 1:53606055-53606077 CAGTTTCTTCATCTATAAAATGG + Intronic
907392801 1:54169218-54169240 CAGTTTGCTCATCTATAAAATGG - Intronic
907716460 1:56930705-56930727 CAGTTTCTTCATCTATAAAATGG + Intronic
907745483 1:57208762-57208784 CAGTTTCCTCATCTACAAAATGG - Intronic
907927845 1:58971401-58971423 CAGTTTCCTCATCTATTAAATGG - Intergenic
907950767 1:59181515-59181537 CAGTTTGTTCATCTGCATGATGG + Intergenic
908104196 1:60824672-60824694 CAGTTTCTTCATCTATGACATGG - Intergenic
908418283 1:63934345-63934367 CAGTTTGCTCATCTGTTAGATGG + Intronic
908436903 1:64115822-64115844 CAGTTTCCTCATCTATTAAATGG + Intronic
908671381 1:66552019-66552041 CAGTTTCTTCATCTATCAAATGG - Intronic
909258882 1:73461159-73461181 CAGTTTACTCATCTATTAAATGG - Intergenic
910239486 1:85071140-85071162 CAGTTTATTCATCTATTTAATGG - Intronic
910445618 1:87296740-87296762 CAGTTTGCTCATCTATAAAAGGG - Intergenic
910558709 1:88566424-88566446 CAGTTTCATCATCTACAAAATGG - Intergenic
911615916 1:100010701-100010723 CAGTTTGATCTTCTACTAGCTGG - Intronic
912305510 1:108562114-108562136 CAGTTTATTTATCTACGAAATGG - Intronic
912527903 1:110298391-110298413 CAGTTTCTTCATCTATAAGATGG + Intergenic
913066218 1:115257868-115257890 CACTTTTTGCTTCTACTACAAGG + Intergenic
913180469 1:116316343-116316365 CAGTTTTTTCATCTATAATATGG - Intergenic
913566022 1:120073283-120073305 CAGTTTCTTCATCTGCAAAATGG - Intergenic
913632111 1:120720270-120720292 CAGTTTCTTCATCTGCAAAATGG + Intergenic
913708016 1:121447750-121447772 CAGTTTCCTCATCTACAAAATGG - Intergenic
914286610 1:146232642-146232664 CAGTTTCTTCATCTGCAAAATGG - Intergenic
914547641 1:148683383-148683405 CAGTTTCTTCATCTGCAAAATGG - Intergenic
914618871 1:149386967-149386989 CAGTTTCTTCATCTGCAAAATGG + Intergenic
914752972 1:150548594-150548616 CAGTTTGCTCATCTGCAAAATGG - Intergenic
914830060 1:151164772-151164794 CAGTTTCTTCATCTGCCAAAAGG + Intronic
915163831 1:153937406-153937428 CAGTTTCCTCATCTACAAAATGG - Intronic
915249257 1:154576817-154576839 CAGTTTCTTCATCTGCAACATGG - Exonic
915289511 1:154873724-154873746 CAGTTTTTTCATCTATAAAATGG - Intergenic
915611670 1:156998495-156998517 CAGTTTTCTCATCTACAAAATGG + Intronic
915876132 1:159613690-159613712 CAGCTTGTTCATCTATTAGTTGG + Intergenic
916786426 1:168090355-168090377 CAGTTTCTTCCTCTACAAAATGG - Intronic
916841174 1:168602802-168602824 CAGTTTCTTCATCTGCAAAATGG - Intergenic
917015139 1:170522208-170522230 CAGTTTCCTCATCTACAAAATGG + Intergenic
917454872 1:175177654-175177676 CAGTTTCTTCATCTCCAAAATGG + Intronic
917485865 1:175454064-175454086 CAGTTTCTCCATCTTCTAAATGG + Intronic
917486613 1:175460655-175460677 CAGTTTGCTCATCTATGAGATGG - Intronic
917967877 1:180189893-180189915 CTGTTTCTTCATCTGCTAAATGG - Intronic
918247591 1:182673323-182673345 CAGTTTTTTCATCTGTAACATGG - Intronic
918535838 1:185573549-185573571 CACTTTCTTCATCTACAAAATGG - Intergenic
918607715 1:186449001-186449023 CATTTTTTTCATCTAATAAAGGG - Intronic
919438553 1:197596050-197596072 CAGTTTTTTCCACTACCACATGG + Intronic
920066847 1:203275137-203275159 CCTTTTGTTCATCTGATACATGG + Intergenic
920361719 1:205422393-205422415 CAATTTGACCATCTACTCCAGGG + Intronic
920444824 1:206007992-206008014 CAGTTTGTTCATCTGTCAAATGG - Intergenic
921155891 1:212438469-212438491 CAGTTTCTTCACCTACAAAATGG + Intronic
921180651 1:212629082-212629104 CAGTTTGTTGATCTGCAAAATGG - Intergenic
921259213 1:213370659-213370681 CAGTTTGCTCATCTATTGAATGG - Intergenic
921291937 1:213666252-213666274 CAGTTTGGTCATCTGATAAATGG - Intergenic
921383458 1:214548131-214548153 CAGTTTCTTCATCTGCAAAATGG - Intronic
921521755 1:216164909-216164931 CAGTTTCTTCATCTGTTAAATGG - Intronic
921594933 1:217044358-217044380 CACTGTGTTCATTAACTACAGGG + Intronic
921617590 1:217288733-217288755 CAGTTTGTTCACCTATAAAATGG + Intergenic
922356065 1:224777025-224777047 CAGTTTCCTCATCTACAAGATGG + Intergenic
922481712 1:225943956-225943978 CAGTTTCTTCATCTATAAAAAGG - Intergenic
922940013 1:229455002-229455024 CAGTTTGTTCATCTATAACAAGG - Intronic
923377724 1:233381252-233381274 CAGTTTCTTCATCTATAAAATGG + Intronic
923588560 1:235297831-235297853 CAGTTTCTTCATCAAATAAAGGG + Intronic
924098400 1:240578475-240578497 TAGTTTGCTCATCTAAAACATGG + Intronic
1063657582 10:8007717-8007739 CAGTTTCCTCATCTACAAAATGG + Intronic
1064278526 10:13929865-13929887 CAGTTTGCTCATCTATCAAATGG + Intronic
1065271151 10:24035179-24035201 CAGTTTGCTCATCTGTTAAATGG + Intronic
1065315369 10:24458642-24458664 CAGTTTGTTCATCTGTGAAATGG + Intronic
1065938348 10:30541742-30541764 CAGTTTCTTCATCTGCAACATGG + Intergenic
1065985104 10:30942816-30942838 CAGTTTGCACATCTCCTAAAAGG + Intronic
1065987462 10:30969328-30969350 CAGTGTTTTCATATACTAAATGG + Intronic
1068574571 10:58670802-58670824 CAGTTTGTTTATCCACTCTATGG - Intronic
1068796826 10:61092305-61092327 TAGTTTGTTTATCTCCTACCTGG + Intergenic
1069190839 10:65487086-65487108 CATTTTTTTCATCTACTCTATGG - Intergenic
1069302046 10:66920293-66920315 CAGTTTGCTCATCTGCAAAATGG - Intronic
1069558691 10:69414649-69414671 CAGTTTCTTCATCTAAAAAATGG + Intronic
1069679947 10:70277352-70277374 CAGTTTTATCATCTATTAAATGG + Intronic
1069694217 10:70374936-70374958 CAGTTTCTTCATCTATAAAATGG - Intronic
1070233417 10:74596304-74596326 CAGTTTCTTCATCTATAAAATGG + Intronic
1070537962 10:77393496-77393518 CAGTTTCCTCATCTACAAAATGG - Intronic
1070748642 10:78950830-78950852 CAGTTGGTTCATCTGCAAAATGG - Intergenic
1070751833 10:78968467-78968489 CAGTTTCTTCATCTGTTAAATGG - Intergenic
1070842356 10:79495998-79496020 CAGTTTCTTCATCTGCAAAATGG + Intergenic
1071578009 10:86744146-86744168 CAGTTTCTTCATCTATAAAATGG - Intergenic
1071854838 10:89613717-89613739 CAGTTTTTTCATCTCCTGCTAGG - Intronic
1072555283 10:96510033-96510055 CAGTCTGCTCATCTACAAAATGG - Intronic
1072555367 10:96510745-96510767 CAGTTTGTTCAGCTTCTAAGAGG + Intronic
1072620056 10:97073792-97073814 CAGTTTTCTCATCTGCAACATGG + Intronic
1073734439 10:106329480-106329502 CAGTTTTTTCATCTGCAAAATGG - Intergenic
1074112889 10:110434904-110434926 CAGTTTGATCATCTATTAAATGG - Intergenic
1074128447 10:110551333-110551355 CAGTTTTTTCATCTATCAAATGG + Intergenic
1074901115 10:117817137-117817159 CAGTTTCTTCATCTGCAAAATGG - Intergenic
1075223701 10:120606193-120606215 CAGTTTGTTCATCTGTAACATGG + Intergenic
1075270161 10:121042543-121042565 CAGTTTTTTCATCTATAAGATGG + Intergenic
1075439731 10:122470290-122470312 CAGTTTCCTCATCTACAACAGGG + Intronic
1075861689 10:125682784-125682806 CAGTTTCTTCATCTGTGACATGG - Intronic
1076043071 10:127268166-127268188 CTGTTTTTTCATCTATCACATGG - Intronic
1076557144 10:131334028-131334050 TAGTTTTTTCATCTATTAAATGG + Intergenic
1076691902 10:132228066-132228088 CTGCTTGTTCATGTACTTCATGG + Exonic
1077059348 11:610946-610968 CAGCTTCTTCATGTACTAGAGGG - Exonic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077673960 11:4181392-4181414 CAGTTTCTTCATCTGTAACATGG - Intergenic
1077713485 11:4558522-4558544 CAGTCTGTTCTTGTACTGCATGG - Intergenic
1078285440 11:9949409-9949431 AAGTTTCTTCATTAACTACAAGG + Intronic
1078653272 11:13215646-13215668 CAGTTTCTTCATCTAGAAAAGGG + Intergenic
1078734822 11:14010285-14010307 CATCTTTTGCATCTACTACAGGG - Intronic
1079132658 11:17756682-17756704 CAGTTTTCTCATCTACCAAATGG + Intronic
1079931411 11:26567091-26567113 CAGTTTCTTCATCTGCAAAATGG - Exonic
1080161165 11:29178173-29178195 CAGTTTCTTCATCTATAAAATGG + Intergenic
1080347822 11:31344540-31344562 CAGTTTCTTCATCTGCAAAATGG + Intronic
1080404418 11:31966366-31966388 CAGTGTCCTCATCTACAACATGG - Intronic
1080615277 11:33940296-33940318 CAGTTTCTTCATCTGGTAAATGG - Intergenic
1080771739 11:35348286-35348308 CAGTTTTTTCACCAACTCCAGGG - Intronic
1080822930 11:35824391-35824413 CAGTTTCTTCATCTGCAAAAGGG - Intergenic
1080855027 11:36104689-36104711 CAGTTTCTTCATCTAGAAAAGGG - Intronic
1081023507 11:37978502-37978524 CATTTTATTCATATAATACATGG - Intergenic
1081178938 11:39964462-39964484 CAGTTTCTTCATCTATAAAAGGG + Intergenic
1081238421 11:40674859-40674881 CAGTTTTTTCATCTATGAAATGG - Intronic
1081555075 11:44151604-44151626 CAGTTTATTCACCTACTGAAGGG + Intronic
1081572743 11:44301795-44301817 CAGTTTGCTCATGTGCTAAATGG + Intronic
1081597738 11:44470871-44470893 CAGTTTCCTCATCTACAAAATGG - Intergenic
1081668020 11:44927821-44927843 CAGTTTCTTCATCTGCAAAATGG + Intronic
1082012364 11:47458766-47458788 CAGATTGTTCATCTGTTAAATGG - Intergenic
1082859749 11:57843947-57843969 AAGTATGTTCTTCAACTACATGG + Intergenic
1083192116 11:61059704-61059726 CTGTTTGTACATCTGCTAAAAGG + Intergenic
1083201453 11:61123433-61123455 CAGTTTCTTCATCTACCAAATGG + Intronic
1083226922 11:61291110-61291132 CAGTTTCTTCATCTATAAAATGG + Intronic
1083265219 11:61543586-61543608 CAGTTTCTTCATCTATGAAATGG + Intronic
1083687603 11:64386013-64386035 CATTTTCTTCATCCACAACATGG - Intergenic
1084219197 11:67667238-67667260 CAGTTTCCTCATCTGCAACATGG + Intronic
1084267391 11:68012062-68012084 CAGTTTCCTCATCTACACCATGG - Intronic
1084520379 11:69659047-69659069 CGGTTTACTCATCTACAACAGGG - Intronic
1084599879 11:70138642-70138664 TAGTTTGTTCATCTGCCAGATGG - Intronic
1085172879 11:74463699-74463721 CAGTTTCCTCATCTACGAAATGG - Intronic
1085261813 11:75210013-75210035 CAGTTTCTTTACCTACTACATGG - Intergenic
1085737945 11:79055694-79055716 CAGTTTCTTCATCTGCAACCTGG - Intronic
1085780437 11:79403442-79403464 CAGTTTCTTCATCTGCAAAATGG - Intronic
1085793101 11:79513007-79513029 CAGATTCCTCATCTATTACATGG + Intergenic
1085950560 11:81326286-81326308 CAGTTTCTTCATCTATAAAAAGG + Intergenic
1086152590 11:83628516-83628538 CAGTTTCTTCATCTATAAAATGG + Intronic
1086248929 11:84790694-84790716 CAGTCTTTGCAACTACTACAAGG - Intronic
1087695415 11:101370376-101370398 CAGTTTGTTTATCTCCTAAATGG + Intergenic
1088880595 11:113970578-113970600 CAGTTTTTTCATCTGCAATATGG + Intergenic
1088966000 11:114721734-114721756 CAGTTTTTTCATCTATAAAATGG - Intergenic
1089158344 11:116419119-116419141 CAGTTTCTTCATCTACAAAATGG + Intergenic
1089202810 11:116734775-116734797 CAGTTTCTTCACCTACAACATGG + Intergenic
1089255021 11:117189577-117189599 CAGTTTCTTCATCTGCAAAATGG + Intronic
1089538648 11:119175971-119175993 CAGTTTATTCATCTATAAAAGGG - Intronic
1089645356 11:119875388-119875410 CAGTTTATTTATCTACAAAATGG + Intergenic
1090027258 11:123178516-123178538 CAGTTTGCTCATCTATAAAATGG + Intronic
1090088581 11:123673423-123673445 CAGTTTCTTCATCTGTAACACGG - Intergenic
1090615636 11:128512185-128512207 CAGTTTCTTCATCTATGAAATGG + Intronic
1090617736 11:128531245-128531267 CAGTTTCTTCATCTACAGAATGG + Intronic
1090741939 11:129670148-129670170 CAGTTTGTTCATCCAGAAAATGG - Intergenic
1091016798 11:132058812-132058834 CAGGTTGTGCATCTACAACAAGG - Intronic
1091157714 11:133388961-133388983 CAGTTTCCTCATCTGCAACATGG - Intronic
1091370713 11:135055960-135055982 CAGTTTCTTCATCTAGCAAATGG - Intergenic
1091572905 12:1705944-1705966 CAGTTTCTTCATCTATAAAATGG + Intronic
1092029503 12:5272431-5272453 CAATTTGTTCCTCAACTACTGGG - Intergenic
1092839242 12:12523188-12523210 CAGTTTCTTCACCTACAAAATGG + Intronic
1092854497 12:12659899-12659921 CAGTTTGCTCATCTATAAAAGGG + Intergenic
1094000963 12:25693590-25693612 CAGTTTTTTCAACTACAAAATGG - Intergenic
1094726824 12:33127813-33127835 CAGTTTCTGCATCTATAACATGG - Intergenic
1096226206 12:49868324-49868346 CAGTTTTTCCATCTGCCACATGG - Exonic
1097170329 12:57109380-57109402 CAGTTTCTTCATCTATAAAATGG - Intronic
1097214009 12:57395612-57395634 CAATTTCTTCATCTACTAAATGG + Intronic
1097279941 12:57838767-57838789 CAGTTTCTTCATCTGCAAAATGG + Intronic
1098228702 12:68351112-68351134 CAGTTTCCTCATCTGCAACATGG + Intergenic
1098250296 12:68561975-68561997 CAGTTTCTTCATCTATAAAATGG - Intergenic
1098254720 12:68605556-68605578 CAGTTTCCTCATCTATAACATGG - Intergenic
1098344643 12:69489045-69489067 CAGTTTTTTCATCTATAAAATGG - Intronic
1098382646 12:69884878-69884900 CAGTTTTTTCATCTGCAAAATGG - Intronic
1098606748 12:72400013-72400035 CAGTTTTTTAATCTAATAAATGG + Intronic
1099707244 12:86171557-86171579 CAGTTTCTTGATCTATTAAATGG - Intronic
1099756912 12:86863372-86863394 CAGATTCTTCATATACTATATGG - Intergenic
1099858354 12:88199304-88199326 CAGTTTCTTCATCTACAAGTTGG + Exonic
1099927531 12:89035927-89035949 CAGTTTCCTCATCTATTAAATGG - Intergenic
1100014077 12:89987657-89987679 CAGTTTGTTCATCTATAAATGGG - Intergenic
1100143948 12:91654237-91654259 CAGTTTCTTCATCTACAAAGTGG - Intergenic
1100163344 12:91887693-91887715 AAGTTTGCTCAGCTAATACAGGG - Intergenic
1100461444 12:94803815-94803837 CAGTTTCTTCATCTGCAAAATGG - Intergenic
1100812694 12:98355385-98355407 CAGTTTGCTCATCTCCAAAACGG + Intergenic
1100986583 12:100207522-100207544 CAGTTTGCTCATCTATTAAATGG + Intronic
1101172945 12:102119004-102119026 CAGTTTCTCCATCTACAAAATGG - Intronic
1101329806 12:103748511-103748533 CAGTTTGTTCATCTACAGAATGG + Intronic
1101330814 12:103756536-103756558 CAGTTTCTTCATCTAAAACGTGG - Intronic
1101594460 12:106151658-106151680 CAGTTTCTGCATCTACAAGATGG + Intergenic
1101708737 12:107245186-107245208 CAGTTTGCTCATCTATAAAATGG + Intergenic
1101871869 12:108572182-108572204 CAGTTTATTCATCTGCAAAATGG + Intergenic
1102016316 12:109650220-109650242 CAGTTTCTTAATCTGTTACATGG + Intergenic
1102406788 12:112680470-112680492 CAGTTTCCTCATCTATTAAATGG - Intronic
1102436710 12:112929902-112929924 CAGTTTATTCATCTGCGAAATGG - Intronic
1102526822 12:113518506-113518528 CAGTTTCTTCATCTGTTAAATGG + Intergenic
1102530867 12:113545769-113545791 CAGTTTCCTCATCTACAAGATGG - Intergenic
1102586303 12:113925458-113925480 CAGTTTCTTCATCTGTAACATGG - Intronic
1102795370 12:115684597-115684619 CAGTTTCTCCATCTACAAAATGG + Intergenic
1103161312 12:118731629-118731651 CAGTTTCTTTATGTCCTACAGGG + Intergenic
1103365731 12:120381684-120381706 CAGTTTCCCCATCTACAACATGG - Intergenic
1103781938 12:123404563-123404585 CAGTTTCCTCATCTACAAAATGG + Intronic
1103847035 12:123908815-123908837 CTGTTTGTCCATCTAGTAAATGG + Intronic
1103915855 12:124375305-124375327 CAGTTTGTTCATCTACAAAATGG + Intronic
1104055411 12:125226479-125226501 CAGTTTCCTCATCTACAAAATGG - Intronic
1104338803 12:127927927-127927949 CAGTTTCTTCATCTGCAAAATGG + Intergenic
1105638436 13:22238677-22238699 CAGTTTCCTCATCTACAAAATGG + Intergenic
1105683699 13:22754892-22754914 CAGTTTTTTCATCTGCAAGAAGG + Intergenic
1106318081 13:28612774-28612796 CAGTTTGTTCATCTGTAAAATGG + Intergenic
1106513415 13:30431390-30431412 CAGTTTCTTCATCTGTTAGAAGG - Intergenic
1108274146 13:48790895-48790917 CAGTTTCTTCATCTGCAAAATGG + Intergenic
1108833688 13:54512734-54512756 CAGTTTCCTCATCTGCTAAATGG + Intergenic
1109160106 13:58961784-58961806 CAATTTCTTCATCTACAAGAAGG - Intergenic
1109374742 13:61477272-61477294 CAGATTTTTGACCTACTACATGG - Intergenic
1110140657 13:72125318-72125340 CTTATTTTTCATCTACTACATGG + Intergenic
1110399450 13:75072807-75072829 CAGTTTATTCATCTATGAAATGG + Intergenic
1110595661 13:77318032-77318054 ATGTTTGATCCTCTACTACAGGG - Intronic
1110827922 13:79994827-79994849 CAGTTTCTTCATCTATAAAATGG - Intergenic
1111794452 13:92899932-92899954 CAGTTTCTTCATCTGCAAAATGG + Intergenic
1112143084 13:96668112-96668134 CAGTTTTTTCATCTGCAAAATGG - Intronic
1112428232 13:99324656-99324678 CAGTTTCTTCATCTATAATAGGG - Intronic
1112445586 13:99461621-99461643 CAGTTTATTCATCTATGATATGG + Intergenic
1112493874 13:99890292-99890314 CAGTTTCCTCATCTAAAACAGGG + Intronic
1112572886 13:100609807-100609829 CAGTTTGTTCATCTATAAAATGG - Intronic
1113323771 13:109264326-109264348 CAATTTCTTCATCTAATCCAGGG + Intergenic
1114628453 14:24144647-24144669 CAGTTTTTTCATCTGTTAAATGG - Intronic
1114891855 14:26934658-26934680 CAGTTTCTTCATCTATAAAATGG + Intergenic
1115373544 14:32647365-32647387 CAGTTTTCTCATCTACCAAATGG - Intronic
1115444577 14:33474938-33474960 CAGTTTTCTCATCTACAAAATGG - Intronic
1115454592 14:33587470-33587492 CAGTTGCTTCATCTATAACATGG + Intronic
1115800832 14:36991603-36991625 CAGTTTCTTCATCTATAACATGG - Intronic
1116967859 14:51032710-51032732 CAGTTTCCTCATCTGCAACATGG + Intronic
1117443658 14:55782253-55782275 TAGTTTGTTCATCTATGAAATGG + Intergenic
1117460861 14:55943220-55943242 CACTTTGTTCATATATGACAAGG + Intergenic
1117777102 14:59194010-59194032 CAGTTTCCTCATCTAGAACATGG - Intronic
1118269454 14:64328761-64328783 CAGTTTTCTCATCTACAAAATGG - Intronic
1118441869 14:65820059-65820081 CAGTTTTTTCATCTGCAAAACGG - Intergenic
1118686816 14:68299642-68299664 CAGTTCCTTCATCTACAAAATGG - Intronic
1118732309 14:68677049-68677071 CAGTTTCCTCATCTATGACAGGG - Intronic
1118811896 14:69281281-69281303 CAGTTTTTTCATCTGCAAAATGG - Intronic
1119058427 14:71448096-71448118 CAGTTTCCTCATCTACAAAACGG - Intronic
1119367395 14:74105599-74105621 CAGATTATTCATCTACTCTAGGG + Intronic
1119384581 14:74249625-74249647 CAGTTTCTTCATCTAGAAAATGG - Intronic
1119682880 14:76606071-76606093 CAGTTTCTTCATCTCTTAAATGG - Intergenic
1119910857 14:78348016-78348038 CAGTTTCCTCATCTACAAAATGG - Intronic
1120093545 14:80362164-80362186 CAGTGTCTTCATCTACAAAATGG + Intronic
1120179366 14:81327981-81328003 CAGTTTTTTCATCTATAACATGG + Intronic
1120543154 14:85776693-85776715 CATTTTGTTCATCTGAAACAGGG + Intergenic
1121059178 14:90888074-90888096 CAGTTTGTTCAACAAATAAATGG - Intronic
1121387372 14:93540427-93540449 CAGTTTGTTCATCTTTGAAATGG + Intronic
1121661192 14:95636361-95636383 CAGTTTCTTCATCTACAAAATGG + Intergenic
1121990885 14:98556154-98556176 CAGTTTCTTCATCTGATAAATGG - Intergenic
1122610349 14:102978066-102978088 CTGACTGTTCATCTACCACAGGG + Intronic
1125422302 15:39516981-39517003 AAGAATGTTCATCTCCTACATGG + Intergenic
1126555727 15:49985477-49985499 CCATTTGTTCATCTCCGACACGG + Intronic
1127230148 15:56982858-56982880 CAGAATGTATATCTACTACAAGG - Intronic
1127622924 15:60751741-60751763 CAGTTTCTTCATCTATAAGAAGG - Intronic
1127915926 15:63454984-63455006 CAGTTTCTTCATCCATTAAATGG - Intergenic
1128002164 15:64203332-64203354 CAGTTTGCTCATCTGCAAAAGGG + Intronic
1128233437 15:66051193-66051215 CAGTTTCTTCATCTGCAAAAAGG - Intronic
1128398098 15:67249829-67249851 CAGTTTCTTCATCTGCAAAATGG + Intronic
1128417863 15:67463542-67463564 CAGTTTCTTCATCTGTGACATGG + Intronic
1128683999 15:69670526-69670548 CAGTTTCTTCATCTATAAAATGG + Intergenic
1129137028 15:73563243-73563265 CAGCTGGTTCATCATCTACATGG + Exonic
1129194894 15:73957941-73957963 CAGTTTGTCCATCTACAAAATGG - Intergenic
1129890814 15:79070619-79070641 CAGTTTCTTCATCTACAAAATGG + Intronic
1130707966 15:86251156-86251178 CAGTTTCTTCATCTATAAAAAGG - Intronic
1130814686 15:87418971-87418993 CAGTTTGTTCATCTGCAAAATGG + Intergenic
1130898183 15:88186939-88186961 CAGTTTTCTCATCTATTAAATGG + Intronic
1132073354 15:98798928-98798950 CAGTTTCTTCATTTATAACATGG - Intronic
1133443902 16:5843682-5843704 CTGTTTTTTCATCTATAACATGG - Intergenic
1133629742 16:7608695-7608717 CAGTTTCCTCATCTATTAAATGG + Intronic
1133864389 16:9628198-9628220 CAGTTAGCTCATCTAGTAAATGG - Intergenic
1134274247 16:12761415-12761437 CAGTTTGGTCATCTGCAAAAAGG + Intronic
1134296974 16:12955014-12955036 CAGTTTTGTCATCTATTAAAAGG - Intronic
1134313021 16:13093360-13093382 CAGTTTGTTCATCTATAAAGTGG + Intronic
1134825902 16:17284113-17284135 CAGTTTCTTCATCTATTAAATGG + Intronic
1135051303 16:19195217-19195239 CAGTTTCTTCATCTATAAAATGG - Intronic
1135129484 16:19840667-19840689 CAGTTTCTTCATCTATAAAATGG - Intronic
1135169006 16:20166443-20166465 CAGTTTCTTCATCTATAAAACGG - Intergenic
1135259921 16:20971928-20971950 CAGTTTCTTCATCTACAAAATGG - Intronic
1135393627 16:22114577-22114599 CAGTTTCCTCATCTACAAAATGG + Intronic
1135644692 16:24151831-24151853 CAGTGTGTTTATCTACGAAATGG + Intronic
1135664168 16:24322018-24322040 CAGTTTCCTCATCTGGTACACGG - Intronic
1135719478 16:24803062-24803084 CAGTTTCCTCATCTGCTAAAAGG + Intronic
1135903882 16:26492572-26492594 CAGTTTCCTCATCTACAAAATGG + Intergenic
1135915931 16:26605441-26605463 CAGTTTCTTCAGCTACAAAATGG + Intergenic
1136412883 16:30086976-30086998 CAGTTTCTTCATCTATAAAATGG - Intronic
1136472634 16:30491801-30491823 CAGTTTTCTCATCTACAAAAAGG - Intronic
1136595521 16:31246566-31246588 CAGTTTCTTCATCTGCAAAATGG + Intergenic
1136622633 16:31440120-31440142 CAGTTTCTTCATCTATAAAATGG - Intronic
1137392855 16:48096015-48096037 CAGTTTCTTCATCTGCAAAATGG + Intronic
1138067358 16:53956104-53956126 CAGTTTCATCATCTATAACATGG - Intronic
1138121047 16:54401344-54401366 CAGTTTCCTCATCTACAAAATGG - Intergenic
1138191406 16:55016955-55016977 CAGTTTCTTCATCTGCAAAATGG - Intergenic
1138563233 16:57814571-57814593 CAGTTTCTTCATCTGTAACATGG - Intronic
1139274839 16:65717951-65717973 CAATTTATTCATCTTCAACATGG - Intergenic
1139285692 16:65811763-65811785 CAGTTTCTTCATCTGCAAGATGG + Intergenic
1139286429 16:65818778-65818800 GAGTTTTTTAATCAACTACATGG + Intergenic
1139324570 16:66142270-66142292 CAGTTTTTTCATCTGTTAAATGG + Intergenic
1140919182 16:79520943-79520965 CAGTTTATTCATCTAAAATATGG - Intergenic
1141051297 16:80766965-80766987 CAGTTTATTCATCTGCAAAATGG - Intronic
1141585353 16:85029887-85029909 CAGTTTCCTCATCTATGACATGG - Intronic
1141638743 16:85329231-85329253 CAGTTTGTTCATCTGTAAAATGG + Intergenic
1141650409 16:85389815-85389837 CAGTTTGCTTATCTATTAAATGG - Intergenic
1141668672 16:85480113-85480135 CAGTTTCATCATCTAGTAAATGG - Intergenic
1141698468 16:85631751-85631773 CCGTTTCTTCATCTACCAAACGG - Intronic
1141800662 16:86306460-86306482 CAGTTTCTTCATCTACACAATGG + Intergenic
1142612450 17:1116717-1116739 CAGTGTCTTCATCTACTAAACGG + Intronic
1142881713 17:2886930-2886952 CAGTTTCTTCATCTGCAAAATGG + Intronic
1143259166 17:5585295-5585317 CAGTTTGCCCATCTATTAAATGG + Intronic
1143261267 17:5600021-5600043 CAGTTTCTTCATCTACAAAATGG + Intronic
1143668090 17:8376328-8376350 CAGTTTCCTCATCTACAACCCGG + Intronic
1144022672 17:11251014-11251036 CGGTTTCCTCATCTACAACATGG - Intronic
1144173410 17:12681851-12681873 CTGTCTGCTCATCTACTGCAGGG - Intronic
1144711566 17:17404726-17404748 CAGTTTCTTCATCTAGAAAATGG - Intergenic
1144890889 17:18493706-18493728 CAGTTTCCTCATCTACAAAATGG + Intronic
1145141334 17:20450612-20450634 CAGTTTCCTCATCTACAAAATGG - Intronic
1145735762 17:27230419-27230441 CAGTTTCTTCATCTGCTAAATGG + Intergenic
1145794580 17:27648316-27648338 CAGTTTCCTCATCTACAAAATGG + Intronic
1145907847 17:28526031-28526053 CAGTTTCCTCATCTGCAACACGG - Intronic
1146540204 17:33687086-33687108 CAGTTTTTTCATGTACAGCAAGG + Intronic
1146694939 17:34901608-34901630 CAGTTTCCTCATCTACAAAATGG + Intergenic
1146939892 17:36837101-36837123 CAGTTTCTTCATCTGTGACATGG - Intergenic
1147322347 17:39653803-39653825 CAGTTTGTCCATCTGCCACATGG + Intronic
1147385609 17:40079753-40079775 CAGTTTCTTCATCTATAAAATGG - Intronic
1148486433 17:47994080-47994102 GAGTTTCCTTATCTACTACATGG - Intergenic
1148964853 17:51426325-51426347 CAGTTTGTTCATCTATGAAATGG + Intergenic
1148999442 17:51742066-51742088 CTGTGTATTCATCTATTACAGGG - Intronic
1149457741 17:56801998-56802020 CAGTTTGTTCATCTGCAAGATGG + Intronic
1149517269 17:57290149-57290171 CAGTTTTCTCATCTATAACATGG + Intronic
1149551064 17:57540129-57540151 CAGTTTTCTCATCTATTAAATGG + Intronic
1150479370 17:65497575-65497597 CAGTTTCCTCATCTACAAAATGG - Intergenic
1150646677 17:66982972-66982994 CAGTTTCTGCATCTACACCATGG - Intronic
1150914673 17:69424475-69424497 CAGTTTGCTGATCTACAAAATGG - Intronic
1151228925 17:72667844-72667866 CAGTTTCTTCATCTATAAAATGG - Intronic
1153546440 18:6210540-6210562 CAGTTTCTTCATCTACATAACGG + Intronic
1155052756 18:22163262-22163284 CAGTTTCTTCATCTGCAAAATGG - Intergenic
1155159809 18:23186363-23186385 CAGTTTGTTCATCTATGAAATGG - Intronic
1156345330 18:36252164-36252186 CAGTTTGTTCAGATATTACCTGG + Intronic
1156396950 18:36707347-36707369 CAGGTTGTGCATCTTCTACTGGG - Intronic
1156719714 18:40055121-40055143 CAGTTTCTTCATTTACAAAATGG - Intergenic
1156798150 18:41074161-41074183 CAGTTTTTTCATCTGTTAAATGG + Intergenic
1156935655 18:42703620-42703642 CAGTTTCCTCATCTACTACTTGG + Intergenic
1157118586 18:44886200-44886222 CAGTTTCTTCATGTAGCACATGG + Intronic
1157208739 18:45722673-45722695 CAGATTGCTCATCTACAAAATGG + Intergenic
1157272200 18:46284441-46284463 CAGTTTCTTCATCTGCTAAATGG + Intergenic
1157500108 18:48184442-48184464 CAGTTTCTTCATCTGCAAAATGG + Intronic
1157715175 18:49880050-49880072 CAGTTTGTTCATCTACTACATGG - Intronic
1158674784 18:59508276-59508298 CAGTTTTATCATCTGCTAAATGG + Intronic
1158882787 18:61797158-61797180 CAGTTTCTTCATCTGCAAAATGG - Intergenic
1159095145 18:63893657-63893679 CAGTTTTCTCATCTACAAAATGG + Intronic
1159558604 18:69970640-69970662 CAGTTTGTTCATTTACATCTCGG - Intergenic
1160773097 19:842279-842301 CAGTTTGTTCATCTGCAAAATGG + Intronic
1162142696 19:8594250-8594272 CAGTTTACTCATCTACAAGATGG + Intronic
1162894911 19:13759387-13759409 CAGTTTCCCCATCTGCTACATGG + Intronic
1163041128 19:14603369-14603391 CAGTTTTCTCATCTACAAAATGG + Intronic
1163573491 19:18097534-18097556 CAGTTTCTTCATCTGCAAAATGG + Intronic
1164052114 19:21592569-21592591 CAGTTTCTTCATCTGCAAAATGG - Intergenic
1164878333 19:31709261-31709283 CAGTTTGCTAATCTGCTACATGG + Intergenic
1166051792 19:40264975-40264997 CAGTTTCTTCATCTATAAAATGG + Intronic
1166553682 19:43684101-43684123 CAGTGTGTTTATCTGCTAAATGG - Intergenic
1166620671 19:44297333-44297355 CAGTTTCTTCAGCCACTCCAGGG - Intronic
1166711559 19:44940941-44940963 CAGTTTGTTCAACTGTAACACGG - Intergenic
1166733102 19:45069586-45069608 CAGTTTGCTTATCTCCTAAATGG + Intronic
1167388664 19:49179950-49179972 CAGTTTCCTCATCTATTAAATGG - Intronic
1167568805 19:50274024-50274046 CAGTTTTTTCATCTATAAAATGG + Intronic
1167710929 19:51110084-51110106 CAGTTTGTTCATCTGTGAAAGGG + Intergenic
1168462691 19:56572686-56572708 CAGTTTGATTATCAACTAGAAGG - Intronic
925982091 2:9185119-9185141 CAGTTTCTTCATCTATAAAATGG + Intergenic
926163455 2:10503775-10503797 CAGTTTCTTCATCTGCAAAATGG + Intergenic
926803493 2:16683283-16683305 CAGTTTGTTCTGCCACTACTTGG + Intergenic
927409662 2:22809703-22809725 CACTTTCTTCATCTGCAACATGG - Intergenic
927409723 2:22810603-22810625 CACTTTCTTCATCTGCAACATGG + Intergenic
927476230 2:23416408-23416430 CAGTTTCTTCATCTAGCAAAAGG + Intronic
928079621 2:28298528-28298550 CATTTTGTTTATCTAGTCCAGGG + Intronic
928303103 2:30144489-30144511 CAGTTTTGTCATCTATTAAATGG + Intergenic
929080420 2:38116833-38116855 CAGTTTCCTCATCTACAAAATGG + Intergenic
929282945 2:40102523-40102545 CAGTTTGTTCAACTGCTAGGTGG + Intronic
929630677 2:43458430-43458452 CAGTTTCCTCATCTATTAAATGG + Intronic
929873463 2:45777066-45777088 CAGTTTGCTCATCTGCAAAATGG + Intronic
931057109 2:58484804-58484826 CAGTTTCTTCATCTGATAAATGG - Intergenic
931308893 2:61059582-61059604 CAGTTTCTTCATCTGCAAAATGG + Intergenic
931961636 2:67489370-67489392 CTGTTTATTCATCCACTTCATGG - Intergenic
931992259 2:67802333-67802355 CAGTTTCCTCATCTACAAAATGG - Intergenic
932143006 2:69296090-69296112 CAGTTTCCTCATCTACAAAATGG + Intergenic
932281571 2:70497479-70497501 CACTTTCTTCACCTACTATATGG + Intronic
932316560 2:70788188-70788210 CTGTTTGTTCATCTGCAAAATGG + Intronic
936415590 2:112306940-112306962 CAGGATTTTCATCTACTCCATGG + Intronic
936991768 2:118374239-118374261 CAGTTTTTTCATCTTTAACATGG + Intergenic
938069180 2:128299562-128299584 CAGTTTCCTCATCCACCACATGG - Intronic
938635003 2:133214315-133214337 CAGTTTCTTCATCTATAAAATGG - Intronic
941113418 2:161443804-161443826 CAGTTTCTTCATCTGCAAAATGG - Intronic
941163995 2:162065790-162065812 CACTTTGATCATTTACTAGAAGG + Intronic
941211005 2:162639382-162639404 CAGTTTCTTCATCTGCAAAATGG - Intronic
941448409 2:165629435-165629457 CAGTTTGTGCATCTCATTCACGG + Intronic
942224193 2:173800829-173800851 CAGTTTCCTCATCTATTAAATGG + Intergenic
942309896 2:174646429-174646451 CAGTTTTCTCATCTATAACATGG + Intronic
943733407 2:191327476-191327498 CAGTGTCTTCATCTCCAACATGG - Intronic
945036678 2:205709488-205709510 CAGTTTCATCATCTACAAAATGG - Intronic
945498621 2:210540653-210540675 CAGTTTCTTCATATACAAAATGG - Intronic
945501781 2:210584637-210584659 CAGTTTCTTCATCTATGACATGG - Intronic
945843458 2:214915396-214915418 AGACTTGTTCATCTACTACAAGG - Intergenic
946018611 2:216623793-216623815 CAGTTTCCTCATCTACAAAATGG - Intergenic
946044413 2:216809829-216809851 CAGTTTCTTCGTCTGCAACACGG - Intergenic
946201762 2:218074720-218074742 CAGTTTTTTCATCTGCAAAATGG - Intronic
946283860 2:218687714-218687736 CAGTTTCTTCATCTATAAAATGG + Intronic
946885687 2:224220236-224220258 CAGTTTGTCCAGCTTTTACAAGG + Intergenic
946953411 2:224902199-224902221 CAATTTGTTCATCTCGTAAAAGG + Intronic
947361960 2:229354724-229354746 CAGTTTTTTCAGCTACAAAATGG - Intergenic
947634985 2:231675478-231675500 CAGTTTCCTCATCTGCTAAATGG - Intergenic
948081204 2:235206825-235206847 GAGTTTGTTTATTTACTCCAGGG - Intergenic
1168795177 20:606420-606442 CAGTTTCTTCATCTATGAAATGG + Intronic
1168842987 20:921576-921598 CAGTTTCCTCATCTATAACATGG + Intergenic
1168983986 20:2031920-2031942 CAGTTTTCTCATCTACAAAATGG - Intergenic
1169096400 20:2903010-2903032 CAGTTTCTTCATCTGCAAAATGG + Intronic
1169487888 20:6048562-6048584 CAGTTTTTTCATCTGCGAAATGG + Intronic
1169694058 20:8367510-8367532 CAATTTTTTCATCTATTAAATGG - Intronic
1170120807 20:12909629-12909651 CAGTTTCTTCATCTATAAAAAGG + Intergenic
1170532119 20:17304093-17304115 CAGGTTTTTCATCTACAAAATGG + Intronic
1170802365 20:19601071-19601093 AAGTTTTCTCATCTACTAAATGG + Intronic
1172032927 20:31994402-31994424 CAGTTTGCTCACCTACAAAATGG + Intronic
1172113427 20:32560639-32560661 CAGTTTCTTCATCTATGAAATGG - Intronic
1172870359 20:38131906-38131928 CAGTTTATTCATCTGTAACATGG - Intronic
1172949788 20:38715558-38715580 CAGTTTACTCATCTATTAAATGG - Intergenic
1173006658 20:39144943-39144965 CAGTGTCTTCATCTATAACATGG + Intergenic
1173047578 20:39527406-39527428 CAGTTTGCTCATCTATAAAACGG + Intergenic
1173154695 20:40597899-40597921 CTGTTTCTTCATCTATGACATGG - Intergenic
1173169083 20:40708331-40708353 CAGTTTGCTCATCTATAAGATGG - Intergenic
1173313713 20:41924542-41924564 CAGTTTTCTCATCTATAACATGG - Intergenic
1173539389 20:43840163-43840185 CAGTTTCTTCATTTGCAACATGG + Intergenic
1173970435 20:47148248-47148270 CAGTTTGCTCATCTGTTAAATGG + Intronic
1174175625 20:48642667-48642689 CAGTTTCTTCATCTGCAAAATGG + Intronic
1174768590 20:53276544-53276566 CAGTTTCTTCATCTATAAGATGG + Intronic
1174869540 20:54170374-54170396 CAGCTTTCTCATCTACTACATGG - Intronic
1174972033 20:55286721-55286743 CAGTTTCCTCATCTACAAAATGG + Intergenic
1175076437 20:56378634-56378656 CAGTTTATTCGTCTACTGAAGGG - Intronic
1175148780 20:56916616-56916638 TCGTTTCTTCATCTATTACATGG + Intergenic
1175181030 20:57147833-57147855 CAGTTTCCTCATCTACCAAATGG - Intergenic
1175259425 20:57665219-57665241 CAGTTTCTTCATCTGCAAAATGG - Intronic
1175539584 20:59739976-59739998 CAGTTTGTTCATCTGTAAAATGG + Intronic
1176124571 20:63469743-63469765 CTGTTTGTTCATCAGCTAAACGG - Intronic
1176146978 20:63569820-63569842 CAGTTTCTTCCTGTGCTACATGG + Intronic
1176984677 21:15422237-15422259 CAGTTTGTTCAGCTGCAAAATGG - Intergenic
1179143498 21:38748068-38748090 GAGTGTGTTCATTTCCTACAAGG + Intergenic
1179310089 21:40187565-40187587 CATTCTGGTCATCTAGTACATGG + Intronic
1181617300 22:24063783-24063805 CAGTGTTTTCATCTGCAACATGG + Intronic
1181910901 22:26237475-26237497 CAGTTTCTTCATCTATAAGATGG + Intronic
1182030002 22:27151198-27151220 CAGTTTGTTCATCTGCAAAATGG + Intergenic
1182474701 22:30570462-30570484 CAGTTTCCTCATCTTCTAAATGG - Intronic
1182712053 22:32329283-32329305 CAGTTTACTCATCTGCTACATGG + Intergenic
1182793585 22:32973757-32973779 CAGCTTCTTCATCTGCTAAAAGG + Intronic
1183353708 22:37347567-37347589 CAGTGTGTTTATCTATGACATGG - Intergenic
1184504822 22:44894375-44894397 CAGTTTTCTCATCTGCAACATGG - Intronic
1184642886 22:45881535-45881557 CAGTTTCTTCATCTTTAACATGG - Intergenic
1184648060 22:45906848-45906870 CAGTTTGCTCATCTGCAAAATGG - Intergenic
949435249 3:4022291-4022313 CAGTTTTCTCATCTACAAAATGG + Intronic
949435336 3:4023282-4023304 CAGTTTGTTCGTCTACAAAATGG - Intronic
949795823 3:7849659-7849681 CAGTTTCTTCATCTATAAAATGG + Intergenic
950136740 3:10586411-10586433 CAGTTTGCTCATCTGCAAAACGG - Intronic
950329859 3:12147727-12147749 CAGTTTCTTCATCTACAAACTGG + Intronic
950393937 3:12719089-12719111 CAGTTTCTTCATCTCCAAAATGG + Intergenic
950444578 3:13028973-13028995 CAGTTTCTTCATCCACAACATGG + Intronic
950481819 3:13248758-13248780 CAGTTTCCTCATCTATAACATGG - Intergenic
950502130 3:13371272-13371294 CAGTTTCTTCATCTGTCACATGG + Intronic
950586740 3:13897676-13897698 CAGTTTCTTCATCTATAAAATGG + Intergenic
950650724 3:14404987-14405009 CAGTTTGTCCATCTATAAAATGG - Intronic
950716512 3:14851308-14851330 CAGTTTCCTCATCTATAACATGG - Intronic
950875502 3:16267824-16267846 CAGTTCATTCAACAACTACAGGG - Intronic
951026607 3:17837735-17837757 CAGTTTTTTCATCTCTAACATGG + Intronic
951039112 3:17968634-17968656 CAGTTTGTTCCTCTATAAAATGG + Intronic
951353477 3:21635413-21635435 CAGTTTCTTCATCTACATAAAGG - Intronic
951741208 3:25925920-25925942 CAGTTTTTTAATTTTCTACATGG + Intergenic
951787047 3:26433312-26433334 CAGTTTTTTCATCTGTCACATGG - Intergenic
952330740 3:32362460-32362482 CAGTTTCTTCATCTGCAAAATGG - Intronic
952526175 3:34212566-34212588 CAGTTTCTTCATCTGCAAAAGGG - Intergenic
952544693 3:34406333-34406355 CAGTTTGTTCATCTATAACATGG - Intergenic
953004850 3:38968791-38968813 CAGTTTCTTCATCTAGAAAATGG + Intergenic
953124860 3:40082048-40082070 CATTTTCTTTATCTACTAAATGG + Intronic
953131635 3:40145097-40145119 CAGTTTCTTCATCTATAAGATGG - Intronic
953563959 3:44015231-44015253 CAGTTTCTTAATCTACAAAATGG - Intergenic
953572171 3:44079725-44079747 CAGTTTCTTCACCTATGACATGG - Intergenic
953922089 3:46959339-46959361 CAGTTTCTTCAACTGCTAGATGG + Intronic
954744566 3:52779797-52779819 CGGTTTGCTCATCTGCTAGACGG + Intronic
955094774 3:55786623-55786645 CAGTTTATTCATCTGTTAAATGG - Intronic
955787462 3:62555542-62555564 CAGTTTCTTCATTTACAAAATGG + Intronic
955981125 3:64528835-64528857 CAGTTTGTTCATCTATAAAATGG - Intronic
956380289 3:68657917-68657939 CAGTTTATTCATCTGCAAAATGG - Intergenic
956515452 3:70041473-70041495 CAGTTTCTTCATCTAAAACATGG + Intergenic
956724733 3:72147586-72147608 CTGTTTGTTCATCTGTAACAGGG + Intergenic
956892040 3:73623005-73623027 CAGTTTTTTCATCTACTAAGTGG + Intronic
956907697 3:73783574-73783596 CAGTTTCCTCATCTACAAAATGG - Intergenic
958902169 3:99900421-99900443 CAGTTTCTTCATCTATTCAATGG - Intronic
959309531 3:104716058-104716080 AAGTTTGTTTATCTAATAGATGG + Intergenic
960031362 3:113058119-113058141 CAGTTTCTTCATCTGCAAGATGG - Intergenic
960137971 3:114124632-114124654 CAGTTTCCTCATCTATAACATGG + Intergenic
960933343 3:122877079-122877101 CTGTTAGTTCATCTACATCAGGG + Intronic
961376038 3:126466588-126466610 CTGTTTCTTCACCCACTACATGG + Intronic
961558004 3:127709890-127709912 CAGTTTGCTCATCTGCAATATGG + Intronic
961874666 3:130013098-130013120 AACTTTGTTCCTCTTCTACAAGG + Intergenic
962046259 3:131762414-131762436 CAGTTTCTTCATCCACAAAATGG - Intronic
963006337 3:140729335-140729357 CAGTTTCTTCATCTATAAAATGG - Intergenic
963518243 3:146334903-146334925 CAGTTGGTTCATCTCCCCCATGG - Intergenic
963836509 3:150063104-150063126 CAGTTTCTTCATCTATAAAATGG + Intergenic
963921200 3:150907657-150907679 CAGTTTATTCATCTATGAAATGG + Intronic
964490681 3:157232733-157232755 CAGTTTGTTCATCCATAAAATGG - Intergenic
964914012 3:161817531-161817553 CAGTTTTTTCATCTATAAAATGG + Intergenic
965420123 3:168447709-168447731 CAGTTTCTTCATCTATAAAATGG - Intergenic
965908622 3:173742510-173742532 CAGCTTCTTCATCTATGACATGG - Intronic
966667983 3:182494175-182494197 CAGTTTCCTCATCTACAAAATGG + Intergenic
966779637 3:183572958-183572980 CAGTTTCTTCATCTATAAAATGG + Intergenic
967105718 3:186253577-186253599 CAGTTTCTTCAGCTACTTGAAGG - Intronic
967422723 3:189291814-189291836 CAGTTTGTTCATCTCCCAATTGG - Intronic
967742219 3:193015909-193015931 CAGTTTCTTCATCTGCAAAATGG + Intergenic
967845997 3:194043291-194043313 CAGTTTGTTCACCTAAAAGATGG - Intergenic
968942750 4:3647347-3647369 CAGATTCTTCATTTTCTACAGGG - Intergenic
969102498 4:4779678-4779700 CAGTTTGCTCATCTGTTAAACGG + Intergenic
969118612 4:4890104-4890126 CAGTTTCCTCATCTCCAACATGG + Intergenic
969263708 4:6050428-6050450 CAGTTTGTCCATTTATTAAAGGG - Intronic
969408062 4:7008039-7008061 TAGTTTGTTCATCTGTAACAGGG + Intronic
969831217 4:9798696-9798718 AAGTTTGTCCATCTACAACACGG - Intronic
970313591 4:14808325-14808347 CAGTTTCTTCATCTATAAAAAGG - Intergenic
970383976 4:15537715-15537737 CAGTTTTTTCATCTACAGAATGG - Intronic
970709427 4:18844308-18844330 CAGTTTGGTCATCTGCAAAATGG + Intergenic
970988314 4:22183978-22184000 CAGTTTCCTCATCTACAAAATGG + Intergenic
972573601 4:40332096-40332118 CAGTTTCTTCATCTATAAAATGG - Intergenic
972601500 4:40576875-40576897 CAGTTTCTTCATCTATAAAATGG - Intronic
973305395 4:48642939-48642961 CAGCTTGTTCATTTGCTAGAAGG - Intronic
974251238 4:59387316-59387338 CTGTTTCTTCATCTGCTCCATGG + Intergenic
974831405 4:67193708-67193730 CAGTTTCCTCATCTACAAAAGGG - Intergenic
974907842 4:68079205-68079227 CAGTTTCTTCATCTATCAAATGG - Intronic
974910373 4:68110621-68110643 CAGTTTTTTCATCTGCAAAATGG + Intronic
975469864 4:74753344-74753366 CAGTTTCTTCATCTATAAAATGG - Intronic
975537272 4:75464309-75464331 CAGTTTCTTCATCTATAAAATGG - Intergenic
976053670 4:81037471-81037493 CAGTTTCTTCATCTATCAAATGG + Intronic
976708103 4:88040117-88040139 CAGTTTTTTCATCTATAAAATGG - Intronic
978223885 4:106310539-106310561 CAGTTTGTTCAGCTTCTTTAGGG - Intronic
978397536 4:108297456-108297478 CAGTTTCTTCATCTATTAAATGG - Intergenic
978416079 4:108477419-108477441 CATGATGTTCATTTACTACATGG - Intergenic
978688029 4:111471866-111471888 TAGTTTGTTCATCTATAAGAAGG - Intergenic
978818912 4:112942459-112942481 CAGTTTTCTCATCTACAAAATGG - Intronic
979369433 4:119866476-119866498 CAGTTTCTTCATCTATGAAATGG - Intergenic
979471164 4:121098634-121098656 CAGTTTCTTCATCTCTTAAATGG - Intergenic
979710374 4:123772260-123772282 CAGTTTTGTCATCTAAAACATGG + Intergenic
981019798 4:140013619-140013641 CAGTTTATTCATCTAGAAAATGG - Intronic
981491895 4:145348558-145348580 CAGTTTTCTCATCAATTACACGG + Intergenic
982144974 4:152377258-152377280 CAGTTTTCTCATCTACTGAATGG + Intronic
982657554 4:158169092-158169114 CAATTTTCTCATCTACTAAATGG + Intronic
984507179 4:180634759-180634781 CAGTTTCTTCATCTGCAAAATGG - Intergenic
984595621 4:181664144-181664166 CAGTTTCTTCATCTGTTAAAGGG + Intergenic
984843720 4:184092340-184092362 CAGTTTGCTCATTTTCCACATGG - Intronic
984884940 4:184441817-184441839 CAGTTTCTTCATCTATAAAATGG - Intronic
985321473 4:188716518-188716540 CAGTATGTTCATCTATAACATGG - Intergenic
986344521 5:6822554-6822576 CAGTGTGTTGACCTCCTACATGG - Intergenic
987738784 5:21878407-21878429 CAGTTTCTTCATCTATAAAATGG + Intronic
987900978 5:24011903-24011925 CATTTTTTTCATCTCCTTCAAGG + Intronic
988265548 5:28944300-28944322 CAGTTTCTTCATCTGCAAAATGG + Intergenic
988875092 5:35435728-35435750 CAGTTTCTTCATCTGCAAAATGG + Intergenic
988893641 5:35648119-35648141 CAGTTTCCTCATCTACGAAATGG - Intronic
989120076 5:37996476-37996498 CAATTTGTTCATATACAAAATGG - Intergenic
989444080 5:41508484-41508506 CAGTTTTTTCATCTGTGACATGG + Intronic
989970083 5:50512950-50512972 CAGTTTCCTCATCTACAAAATGG + Intergenic
990292542 5:54367574-54367596 CAGTTTCTTCATCTAAGAAATGG - Intergenic
990382130 5:55228375-55228397 CAGTTTCTGCATCTACTCCTGGG - Intergenic
990659216 5:57994354-57994376 CAGATATTTCATTTACTACATGG + Intergenic
990731430 5:58813104-58813126 CAGTTTCTTCATCTGCAAAATGG + Intronic
990844243 5:60119596-60119618 CAGTTTCTTCATTTATTATAAGG + Intronic
990950392 5:61292974-61292996 CAGTTTTCTCATCTACGAAATGG - Intergenic
991462824 5:66877400-66877422 CAGTTTCCTCATCTGCAACATGG - Intronic
991596782 5:68314673-68314695 CAGTTTCTTCATCTATAAAATGG + Intergenic
991945638 5:71896041-71896063 CACTTTGCTCATCTGCAACATGG - Intergenic
992092365 5:73328694-73328716 CAGTTTCTTCATCTGCAAAATGG + Intergenic
992559040 5:77932145-77932167 CAGTTTCCTCATCTATCACATGG - Intergenic
994679058 5:102862772-102862794 CAGTTTCTTCATCTGCAAAATGG - Intronic
996363083 5:122672014-122672036 CAGTTCCTTCATATACTCCACGG - Intergenic
997423957 5:133790327-133790349 CAGGTTTCTCATCTACAACATGG + Intergenic
997801330 5:136865544-136865566 CAGTTTTTTCATCTATAAAATGG + Intergenic
997935542 5:138107392-138107414 CAGTTTCTTCATCTATAAAATGG - Intergenic
997982740 5:138479315-138479337 CAGTTTCCCCATCTACTTCATGG + Intergenic
998407973 5:141884713-141884735 CCGTTTCTTCATCTACTAAATGG + Intergenic
998919384 5:147051278-147051300 CAGTTTCCTCATCTATAACATGG + Intronic
999743641 5:154575545-154575567 CAGTTTATTCATCTATAAAATGG - Intergenic
999829632 5:155306383-155306405 CAGTCTTTTCATCTACAAAATGG - Intergenic
1000191626 5:158916549-158916571 TAGTTTATTCACCTACTAAATGG - Intronic
1000211238 5:159107535-159107557 CAGTTTCTTCATCTGCAAAATGG - Intergenic
1000964902 5:167644627-167644649 CAGTTTGTTCATCTGCCATATGG - Intronic
1001034457 5:168287578-168287600 CAGTTTGCTCATCTATGAAATGG + Intergenic
1001236587 5:170034935-170034957 TAGTTTGCTTATCTATTACATGG + Intronic
1001284621 5:170413528-170413550 CAGTTTCTTCATCTGCAAGATGG + Intronic
1001300507 5:170530396-170530418 CAGTTTCTTTATCTACAAAATGG - Intronic
1001752197 5:174140218-174140240 CAGTTTCTTCATCTATGAAATGG + Intronic
1001757323 5:174180669-174180691 CAGTTTATTCATCTGCAAAATGG - Intronic
1001781003 5:174369080-174369102 CAGTTTCTTCATCTATTAGATGG - Intergenic
1001876398 5:175205568-175205590 CAGTTTCTTCATCTGTTAAAAGG - Intergenic
1002311178 5:178314770-178314792 CAGTTTCTTCATCTATAAAATGG - Intronic
1002341506 5:178519215-178519237 CAGTTTCCTCATCTACAAAATGG - Intronic
1003244999 6:4375998-4376020 CAGTTTGTTCATCTCAAAAATGG - Intergenic
1003378682 6:5602972-5602994 CAGTTTCTTCATCTATAAAATGG - Intronic
1003906923 6:10710018-10710040 TATTTTGTACATCTACTACTTGG - Intergenic
1004187234 6:13431283-13431305 CAGTTTCTTCATCTGCAAAATGG - Intronic
1004484831 6:16056640-16056662 CAGTTTGCTCATCTATAAAATGG + Intergenic
1005061263 6:21779220-21779242 CAGTTTCTTCATCTGCTAAATGG - Intergenic
1005162867 6:22884698-22884720 CAGCTTGTTAATCCACTACTTGG + Intergenic
1005183112 6:23129650-23129672 CAGTTTGTTCATGTGCAAAATGG + Intergenic
1005400225 6:25424337-25424359 CACTTTGTTGTTCTACTCCAGGG + Intronic
1006134083 6:31885164-31885186 CAGTTTCTTCATCTAAAAAATGG + Intronic
1006142704 6:31940166-31940188 CAGTTTCTTCATCTGCAAAAGGG + Intronic
1006629317 6:35419971-35419993 CAGTTTCTTCACCTAGAACAGGG - Intronic
1006683317 6:35812729-35812751 CAGTTTCCTCATCTACAAAATGG - Intronic
1006928854 6:37675281-37675303 CAGTTTCTTCATCTGCAAAATGG + Intronic
1007404476 6:41626201-41626223 CAGTTTGTTCTTCCACAAAATGG + Intergenic
1007460667 6:42016442-42016464 CAGTTTCCTCCTCTACAACATGG + Intronic
1007587714 6:43002022-43002044 CAGTTTTCTCATCTACAAAATGG - Intronic
1007636900 6:43305113-43305135 CAGTCTGTTCATCTCCCAAATGG + Exonic
1007788512 6:44295827-44295849 CAGTTTCTTCATCTATAACGTGG + Intronic
1007999488 6:46343885-46343907 CAGTTTATTCATCAATTAAAAGG + Intronic
1008045489 6:46847891-46847913 CAGCTTGTCCCTCTACTCCAAGG + Intergenic
1008204864 6:48642531-48642553 CAGTTTCTTCATCTGCAAAATGG + Intergenic
1009622493 6:66095485-66095507 AATTTTGTTCATCTACAAAATGG - Intergenic
1009934478 6:70217808-70217830 CAGTTTCTTCATCTACAAGATGG + Intronic
1010119839 6:72362617-72362639 CAGTTGTTTTATCTACTATATGG - Intronic
1010365958 6:75051295-75051317 CAGTTTGTTTATCTGCAAAATGG - Intergenic
1011487845 6:87861508-87861530 GAGGTAGTTCTTCTACTACAGGG - Intergenic
1012633818 6:101509612-101509634 CAGATTCTTCATCTTCTACCTGG - Intronic
1013042102 6:106445673-106445695 CAGTTTCTTCATCTGCAAAATGG - Intergenic
1013537350 6:111075353-111075375 CAGTTTCTTCATCTGCAAAATGG + Intergenic
1013766590 6:113581219-113581241 CAGTTTCTTCATCTATTAAATGG - Intergenic
1014083373 6:117313623-117313645 CAGTTTCTTTATCTACAAAATGG - Intronic
1014128982 6:117810110-117810132 CTGTTTTTTCATCTTCTTCATGG + Intergenic
1014264436 6:119259762-119259784 CAGTTTCCTCATCTACAAAATGG + Intronic
1014435160 6:121412577-121412599 CTGTTTGCTCATCTACTAAATGG + Intergenic
1014652073 6:124052176-124052198 CAGATTCTTCATCTATAACATGG - Intronic
1014668977 6:124275940-124275962 CAGTTTCTTCATCTACAATATGG - Intronic
1014743634 6:125174046-125174068 CAGTTTGCTCATCTACAAAATGG + Intronic
1016555875 6:145337537-145337559 CAGTTTCTTCATCTATTAAATGG + Intergenic
1016760513 6:147731097-147731119 CAGTTTCTTCATCTATAAAATGG - Intronic
1017043101 6:150323530-150323552 CAGTTTCTTCACCTGCTAAATGG + Intergenic
1017449527 6:154541586-154541608 CAGTTTGTTCATCTGTGAAATGG - Intergenic
1017810948 6:157982776-157982798 CAGTTTGCTCATCTGCAAAATGG - Intronic
1018278163 6:162155158-162155180 CATTTTGTTCATCTCCTAATGGG - Intronic
1018325842 6:162667807-162667829 CAGTTTCTTCATCTATAAGATGG + Intronic
1018449483 6:163893808-163893830 CAGTTTCTTCATCTATAAAATGG + Intergenic
1018880817 6:167878245-167878267 CAGTTTCTTCATCTTCAAAACGG + Intronic
1019114026 6:169742263-169742285 CAGTTTCTTCATCTATAAAATGG - Intronic
1020387050 7:7618244-7618266 CAATATTTTCATCTACTACATGG - Intergenic
1020893502 7:13909857-13909879 CAGTTTCCTCATCTATTAAATGG + Intronic
1020965033 7:14854731-14854753 CAGTTCAGTCATCTACTACAGGG - Intronic
1021398250 7:20178016-20178038 CATTTTATTCATCTAATAGAAGG - Intronic
1021834620 7:24657118-24657140 CAGTTTGTTTATCCATTACCTGG + Intronic
1022229796 7:28403537-28403559 CAGATTCTTCATCTACAAAATGG - Intronic
1022403485 7:30064152-30064174 CACTTTGTTCATCTATAAAATGG + Intronic
1022419974 7:30211027-30211049 CAGTTTATTCATCTGCAAAATGG - Intergenic
1022593947 7:31693534-31693556 CAGTTTCCTCATCTTCAACATGG + Intronic
1023118791 7:36888578-36888600 CAGTTTCTTCATCTATAAAATGG + Intronic
1023153389 7:37223460-37223482 CAGTTACCTCATCTACAACATGG + Intronic
1023306222 7:38830881-38830903 CAGTTTATTCTTCTACAAAATGG - Intronic
1026438942 7:70426011-70426033 CAGTTTCCTCATCTATTAAATGG - Intronic
1026856863 7:73760931-73760953 CAGTTTCCTCATCTACAAAATGG - Intergenic
1027596708 7:80183523-80183545 CAGGCTGTTCAGCTACAACATGG - Intronic
1028279739 7:88907587-88907609 CAGTTTCATCATCTACAAAATGG - Intronic
1029281301 7:99437658-99437680 CAGTTTGTGCAGCAACTACAAGG - Intronic
1029614577 7:101648285-101648307 CAGTCTCTTCATCCACAACATGG - Intergenic
1029841370 7:103367066-103367088 CAGTTTGCTCATCTTATAAAGGG + Intronic
1030343247 7:108404713-108404735 CAGTTTTCTCATCTATTAGATGG - Intronic
1030653612 7:112142154-112142176 CAGTTTCTTCATCTGCAAAAGGG - Intronic
1030800227 7:113840660-113840682 CAGATTCCTCATCTACTAAATGG + Intergenic
1031059371 7:117033026-117033048 CAGTTTGTTCATCTGTAAAATGG + Intronic
1031098078 7:117444600-117444622 AAGTTTGGTCAGCTACTGCAAGG + Intergenic
1031467998 7:122137227-122137249 CAGTTTCTTCATCTATAAAATGG - Intronic
1031994308 7:128219090-128219112 CAGTTTCTTCATCTATAAAATGG + Intergenic
1032190068 7:129759879-129759901 CAGTTTGCTCATCTATAAAACGG - Intergenic
1033230408 7:139593253-139593275 CAGTTTCTTCATCTATCAAATGG + Intronic
1034938779 7:155216661-155216683 CAGTTTATTCATCTCTTAAATGG - Intergenic
1035953313 8:4048477-4048499 CAGTTTGTTCATCTTTAAAATGG - Intronic
1035961162 8:4139826-4139848 CACTTTGTTCTTCTGCTCCAAGG - Intronic
1036657435 8:10686315-10686337 CAGTTTCTTCATCTGTTAAATGG + Intronic
1037601283 8:20396466-20396488 TAGTTTGTTCACCTGCCACATGG - Intergenic
1038426550 8:27467770-27467792 CAGTTTGCTCATCTGCTAAATGG - Intronic
1038468041 8:27784574-27784596 CAGCTTTCTCATCTACAACATGG - Intronic
1038560585 8:28575680-28575702 CAGTTTCTTCATCTGCAAAATGG + Intergenic
1038675695 8:29620901-29620923 CAGTTTCTTCATCTATCAAACGG - Intergenic
1038692330 8:29774553-29774575 CAGTTTCTTCATCTGTTAAATGG - Intergenic
1038882175 8:31627116-31627138 GGGTTTCTTCATCTACTCCAAGG - Intergenic
1039837392 8:41267699-41267721 CAGTTTTCTCATCTATTAGATGG - Intronic
1039914552 8:41850144-41850166 CAGTTTCTTCATCTGCAAAATGG - Intronic
1040949998 8:52928736-52928758 CAGTTTGTTTATCTATTAACTGG + Intergenic
1041876038 8:62688307-62688329 CAGTTTCTTTATCTACAAAATGG + Intronic
1042161280 8:65898263-65898285 CAGTTTCTTCATCTGTTAAAAGG - Intergenic
1043377167 8:79663367-79663389 CAGTTTCTTCATCTGCAAAATGG + Intronic
1043932667 8:86108485-86108507 CAGTTTCCTCATCTACAAAATGG - Intronic
1044110878 8:88271983-88272005 CAGTTTGTCCATCTATAAAATGG + Intronic
1044252207 8:90016841-90016863 CAGTTCCTTCATCTACAAAATGG - Intronic
1044627456 8:94248021-94248043 CAGTTTTCTCATCTACCAAATGG - Intergenic
1045341692 8:101260634-101260656 CAGTTTCCTCATCTACAAAATGG + Intergenic
1045418263 8:101988480-101988502 CAGTTTCTTCAACTAAAACATGG + Intronic
1045704753 8:104909148-104909170 CAGTTTCTTCATCTGCAAAATGG + Intronic
1046556652 8:115781635-115781657 CAGTTTCCTCATCTACAAAATGG - Intronic
1046627354 8:116589354-116589376 CAGTTTCTCCATCTACAAAATGG + Intergenic
1046926463 8:119794599-119794621 CAGTTTCTTCATCTATAAAATGG + Intronic
1047051808 8:121121055-121121077 CAGTTTTTTCATCTATAAAATGG + Intergenic
1047221008 8:122918172-122918194 CAGTTTTTTCATCTGTCACATGG - Intronic
1047481389 8:125286741-125286763 CAGTTTCTTCATCTACAAAATGG - Intronic
1047577443 8:126172881-126172903 CAGTTTCTTCATCTATAAAATGG - Intergenic
1047672748 8:127166115-127166137 CAGTTTCCTCATCTATTAGATGG + Intergenic
1047716701 8:127602370-127602392 CAGTTTTTTCATCTATAAAATGG + Intergenic
1047801799 8:128317887-128317909 CAGTTTTTTTATCTAGTAAATGG + Intergenic
1047818217 8:128488414-128488436 CAGTTTGCTCATATACTAGGAGG + Intergenic
1047868846 8:129060107-129060129 CAGCTTGTTCATCTGCAAAATGG - Intergenic
1047962190 8:130018551-130018573 CAGTTTGTTCATCTGTGAAATGG + Intergenic
1048050214 8:130809316-130809338 CAGTTTCTTCATCTAGAAAATGG + Intronic
1048166681 8:132067821-132067843 CAGTTTGTTCATCTACAAAATGG - Intronic
1048769560 8:137881374-137881396 CATTTTCCTCATCTACTAAATGG - Intergenic
1049111261 8:140645318-140645340 CAGTATGATTATTTACTACATGG - Intergenic
1050276492 9:4006634-4006656 CAGTGTTTTCATCTAGTGCATGG - Intronic
1050625556 9:7500400-7500422 CAATTTTTTCATCTACAACATGG - Intergenic
1050698225 9:8303515-8303537 AAATTTGTTCTTCTACTCCATGG + Intergenic
1050736693 9:8771766-8771788 TAGTTTGGTCATCTAAAACAAGG - Intronic
1051582374 9:18691240-18691262 CAGATAGTTAAGCTACTACATGG + Intronic
1051592292 9:18788505-18788527 CAATTTGCTCAGCTAGTACATGG - Intronic
1051717731 9:20002528-20002550 CAGTTTACTCATCTACAAAATGG - Intergenic
1052025386 9:23568191-23568213 CAGTTTTCCCATCTACAACATGG + Intergenic
1052345176 9:27402073-27402095 CAGTTTCTTCATCTATAAAATGG + Intronic
1052374452 9:27702414-27702436 CAGTTTCATCATCTACAAAATGG - Intergenic
1052892271 9:33712843-33712865 CAGTTTGTTCATCCAGAAAATGG - Intergenic
1053151426 9:35745908-35745930 CAGTTTCCTCATCTACAAAATGG + Intronic
1053269728 9:36741703-36741725 CAGTTTCTTCATCTATCATATGG + Intergenic
1053286386 9:36852036-36852058 CAGTTTCTTCATCTATAAAATGG + Intronic
1053300298 9:36944327-36944349 CAGTTTCTTCATCTAAAAAATGG - Intronic
1053464081 9:38292174-38292196 CAGTTTCTTCATCTATAAAATGG - Intergenic
1055096074 9:72415451-72415473 CAGTTTTTTCATCTAGAAGATGG + Intergenic
1055108563 9:72537383-72537405 CTCTTTCTTCATCTACCACAGGG + Intronic
1055534639 9:77227042-77227064 CAGTTTTATCATCTATAACATGG + Intronic
1055591590 9:77820836-77820858 CAGTTTCTTCATCTATAAGATGG + Intronic
1055621630 9:78131711-78131733 CAGTTTTTTCATCTACGTGATGG - Intergenic
1056009270 9:82309984-82310006 CAGTTTTTTCATCTATTAACTGG - Intergenic
1056105466 9:83342449-83342471 CAGTTTCTTCATCTATTAAATGG - Intronic
1057225564 9:93291279-93291301 CAGTTTGCTCATCTGCCAAAGGG - Intronic
1057816398 9:98299137-98299159 CAGTTTCTTCATCTAAAAAATGG + Intronic
1057825027 9:98366128-98366150 CAGTTTCCTCATCTAGAACATGG + Intronic
1057878188 9:98773574-98773596 CAGTTTCCTCATCTACTAAAAGG + Intronic
1057882715 9:98805441-98805463 CAATTTGCTCATCTATTAAATGG - Intergenic
1058383036 9:104399690-104399712 CAGTGTGTTCACCTTCCACATGG - Intergenic
1058561909 9:106239414-106239436 CAGTTTCTTCATCTATAAAATGG - Intergenic
1058700208 9:107593972-107593994 CAGTTTTTTCATCTGCAAAATGG + Intergenic
1058759150 9:108113072-108113094 CAGTTTGGTCATCTGCATCAAGG + Intergenic
1059432141 9:114256715-114256737 CAGTTTTGTCATCTATAACATGG - Intronic
1059465955 9:114469025-114469047 CAGTTTCTTCATCTAGAAAATGG + Intronic
1059647063 9:116278034-116278056 CAGTTTTTTCCTCTACAAAACGG - Intronic
1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG + Intergenic
1059962447 9:119578512-119578534 CAGTTTCTTCATCTATAAAATGG - Intergenic
1060001579 9:119963646-119963668 CAGTTTCTCCATCTACAAAATGG + Intergenic
1060014792 9:120077781-120077803 CAGTTTCTTCATCTATAAAATGG - Intergenic
1060035137 9:120248885-120248907 CAGTTTCTTCATCTGCAAAATGG + Intergenic
1060562607 9:124558870-124558892 CAGTTTGTTCATTTACAAAGGGG - Intronic
1060611961 9:124974831-124974853 CAGTTTCTTCATCTATCAAATGG - Intronic
1060650391 9:125321042-125321064 CAGTTTCTTCATCTATAAAATGG - Intronic
1060749554 9:126159967-126159989 CTGTTTCCTCATCTACAACACGG - Intergenic
1061032323 9:128092749-128092771 CAGTTTCTTCATCTACGAAATGG - Intronic
1061229738 9:129308257-129308279 CAGTTTCTCCATCTTGTACATGG - Intergenic
1061448866 9:130658127-130658149 CAGTTTGTTCATCTGTGAAATGG - Intergenic
1186646882 X:11516647-11516669 CAGTTTTTTCATCTGCAAAATGG - Intronic
1186766353 X:12774234-12774256 CAGTTTATTCATCTGTAACATGG + Intergenic
1187044823 X:15636846-15636868 CAGTTTCTCCATCTGCAACAGGG - Intronic
1187120143 X:16397607-16397629 CAGTTTCTTCATCTGCAAAATGG - Intergenic
1187155480 X:16717057-16717079 AAGTTTATTCACCTACTAGATGG + Intergenic
1187296099 X:18002184-18002206 CAGTTTCTTCATCTAAAAAATGG + Intergenic
1188254508 X:27944002-27944024 CAGTTTACTCATCTACAAAATGG + Intergenic
1189085654 X:38020884-38020906 CAGTTTATTCATCTGTTAAATGG - Intronic
1189308991 X:40006989-40007011 CAGTTTCTTTATCTACAAAATGG + Intergenic
1189536852 X:41944193-41944215 CAGTTTCTTAACCTATTACATGG + Intergenic
1189538194 X:41958302-41958324 CAGTTTTTTCATCTATAAAATGG + Intergenic
1189717352 X:43880503-43880525 CAATTGCTTCATCTGCTACATGG - Intronic
1190408640 X:50112786-50112808 CAGTTTCCTCATCTATTAAACGG + Intergenic
1190476901 X:50837127-50837149 CAGTTTTCTCATCTGCCACATGG - Intergenic
1190764408 X:53464151-53464173 CAGTTTGTTTATTTTCTACCTGG + Intergenic
1191668616 X:63728633-63728655 CAGTTTTTTCATCTGCAAAATGG + Intronic
1191736288 X:64391764-64391786 CAGTTTCTTCATCTATAAGATGG - Intronic
1191953435 X:66618897-66618919 CAGTTTTTTCATCTGCAAAATGG + Intronic
1192205910 X:69095906-69095928 CAGTTTGTTCACCTATAAAATGG - Intergenic
1192225582 X:69225345-69225367 CAGTTTCTTCATCTGCAAAAAGG + Intergenic
1192235460 X:69292684-69292706 CAGTTTCCTCTTCTACTTCATGG + Intergenic
1192244592 X:69362028-69362050 CAGTTTGCTCATCTATAAGATGG + Intergenic
1192473798 X:71421541-71421563 CAGTTTTTCCATCTACAAAAGGG - Intronic
1193149679 X:78111855-78111877 CATTTTGTTAATCAACTCCATGG - Intronic
1194684515 X:96896467-96896489 TAGTTTCTTCATCTACAAAATGG + Intronic
1194692102 X:96999642-96999664 CATTTTGTACATTTACTTCATGG - Intronic
1195347999 X:103970312-103970334 CAGTTTCTTCATCCACAAAACGG + Intergenic
1195359443 X:104068529-104068551 CAGTTTCTTCATCCACAAAACGG - Intergenic
1195652235 X:107297075-107297097 CAGTTTCCTCATCTACAATATGG - Intergenic
1195676145 X:107508508-107508530 CAGTTCCTTCATCTACAAAATGG - Intergenic
1195943404 X:110183457-110183479 CAGTTTGCTCATCTACAAAATGG + Intergenic
1196052940 X:111324572-111324594 CAGTTTCTTCATCTGCAAAATGG + Intronic
1197149143 X:123201239-123201261 CAGTTTCTTCATCTACAAAATGG + Intronic
1198429625 X:136552679-136552701 CAGTTTCTTCATCTATAAAATGG - Intronic
1198541282 X:137642773-137642795 CAGTTTTCTCATCTGCTAAATGG - Intergenic
1199271363 X:145886554-145886576 CAGTTTGTTCATCTATGAAATGG - Intergenic