ID: 1157716054

View in Genome Browser
Species Human (GRCh38)
Location 18:49888167-49888189
Sequence ATTCTTTCTTGGGGGAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157716044_1157716054 30 Left 1157716044 18:49888114-49888136 CCTATAAAGCAAAGTTTTTCAGC 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1157716054 18:49888167-49888189 ATTCTTTCTTGGGGGAGTAAGGG 0: 1
1: 0
2: 0
3: 18
4: 214
1157716045_1157716054 8 Left 1157716045 18:49888136-49888158 CCTTGACACTGTCAACATTCTGG 0: 1
1: 1
2: 1
3: 72
4: 509
Right 1157716054 18:49888167-49888189 ATTCTTTCTTGGGGGAGTAAGGG 0: 1
1: 0
2: 0
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157716054 Original CRISPR ATTCTTTCTTGGGGGAGTAA GGG Intronic
901346885 1:8552721-8552743 ATTCTGTTTTATGGGAGTAATGG + Intronic
901720738 1:11195132-11195154 ATTCTTTCTTTGGAGATTATAGG - Exonic
903266248 1:22159815-22159837 GTTCTTTCTTGCAGGAGTAAAGG + Intergenic
903751410 1:25623556-25623578 ATTTATTTTTGGTGGAGTAATGG - Intronic
904629222 1:31828982-31829004 ACTCTTTTTTGGGGGAGTGGGGG - Intergenic
905456474 1:38091647-38091669 GTTCTTTATTGGGGGAGTGGAGG - Intergenic
905818205 1:40968406-40968428 AATCTTTTTTGGGGGGGTGATGG - Intergenic
906403809 1:45525425-45525447 TTTCTTTCTTGCAGGAGCAAGGG + Intergenic
906990786 1:50735507-50735529 TTTCTTTCTAGGGGAAGAAATGG - Intronic
907329201 1:53660314-53660336 CTGCTTTCTGGGTGGAGTAAGGG + Intronic
907848121 1:58228357-58228379 ATTGCTTTTTGGGGGGGTAAGGG + Intronic
907937242 1:59053203-59053225 ATTCATTCTTCTGGTAGTAATGG + Intergenic
908184780 1:61642106-61642128 ATTCTTATTTGGAGGAGAAAAGG + Intergenic
908396763 1:63732296-63732318 TTTCTTTTTTTGGGGGGTAAGGG - Intergenic
908728852 1:67205497-67205519 ATTGTTCCTTAGGGGAGAAATGG + Intronic
909602134 1:77472052-77472074 ATCCTTTCTTGGGTGAATACTGG - Intronic
916622259 1:166511891-166511913 ATTCTTTGTTGGTGGAGGAGAGG - Intergenic
917234392 1:172874784-172874806 ATTCTTGCTTTGGAGAGTCATGG - Intergenic
917344308 1:174013125-174013147 ATGGTTCTTTGGGGGAGTAAAGG + Intronic
917845490 1:179016671-179016693 ATTATTACTTGGGGTAGTAGGGG - Intergenic
922556122 1:226533654-226533676 ATTCTTCCTTGGGTCATTAAAGG + Intergenic
922778814 1:228233703-228233725 ATTTTATCTTGGGTGAGTATTGG + Intronic
924035430 1:239931439-239931461 ACTCTTTCTTGTGGGGGAAAGGG - Intergenic
924151611 1:241135561-241135583 ACTCTTTTTTGAGGGAATAATGG + Intronic
924477065 1:244391733-244391755 ATTCTTCCTTTGTGGAGTAGTGG + Intergenic
1065073060 10:22047970-22047992 TTTCTTTCTTGGGGGAGGATTGG + Intergenic
1071935686 10:90527437-90527459 ATTAATTCTTGGAGGAGTAGAGG - Intergenic
1072695896 10:97602478-97602500 ATTCTTTGTTGGGCAAGCAAAGG + Intronic
1074276683 10:112009220-112009242 ATTCCTTCTTGAGGGATTATTGG + Intergenic
1074545812 10:114401640-114401662 ATTTTTGCTTGGGTGAGTCATGG + Intronic
1075040122 10:119101470-119101492 AATCTTTATTGGGAGAGTCACGG + Intergenic
1075205524 10:120444555-120444577 ATTCTTTCTGGATGAAGTAAGGG + Intergenic
1075303733 10:121348901-121348923 ATCTTTTCTTGGGGGAGTGAAGG + Intergenic
1080139163 11:28894194-28894216 AATGTTTCTTGGAGGAGTCATGG - Intergenic
1080446758 11:32344804-32344826 GTTCTTTCCTGGGGGATGAAGGG - Intergenic
1082833920 11:57638722-57638744 ATTCTCTCTTGGGGAAGGGAGGG + Intergenic
1082902843 11:58274684-58274706 GTTCTTGCTTAGGGGAATAAGGG + Intergenic
1084130544 11:67130630-67130652 TTTCTATTTTGGGGGGGTAACGG + Intronic
1085287395 11:75372589-75372611 ATTTTTTGTTGGGGGAGGAAAGG + Intergenic
1088162698 11:106892615-106892637 ATTCTTTGTTGAAGGAGGAAGGG - Intronic
1091666352 12:2421420-2421442 ATTCTTTTTTGAGGGACAAATGG + Intronic
1091698680 12:2645275-2645297 GGTCTTTCTTGGGGAAGAAAGGG - Intronic
1091937400 12:4444833-4444855 CTTCTTTCTTGGAGAAGGAAGGG - Intronic
1092582388 12:9857174-9857196 CTCCTTTCTTGGTGGAGTATTGG + Intronic
1095130258 12:38533673-38533695 AGTCTTTCTGGGGGGAGTAGGGG - Intergenic
1096028113 12:48385994-48386016 ATTTTTTCTTGGGGCACCAATGG - Intergenic
1096137309 12:49213178-49213200 ATTCTTCCATGTGGGAGGAAAGG + Intronic
1096403477 12:51325826-51325848 ATTCTTTATTGGTTGAGAAAGGG - Intergenic
1097514083 12:60581711-60581733 ATTTATACTTGGGGAAGTAAAGG + Intergenic
1098470803 12:70841184-70841206 TTTTTTTGTTGGGGGGGTAAGGG - Intronic
1098816515 12:75172053-75172075 ATCCTTTCTTTGGGGGGTGAGGG - Intronic
1099477774 12:83128468-83128490 ATTCTATTTTGGGGGAGGATAGG + Intronic
1100143588 12:91649840-91649862 ATTCCTTCTGGAAGGAGTAAAGG - Intergenic
1100575466 12:95888010-95888032 AAGCTCTCTTGGGGTAGTAAGGG + Intronic
1101088216 12:101257741-101257763 AATATTTGTTGAGGGAGTAAAGG - Intergenic
1101155341 12:101922540-101922562 ACTATTTGTTGGGTGAGTAAAGG + Exonic
1101372759 12:104144711-104144733 ATTCTTTGGTGGGGGGCTAAGGG + Intergenic
1102657956 12:114499183-114499205 ATTCTTTGTTGGGGGAGGTTGGG - Intergenic
1103047003 12:117744452-117744474 TTCCTTTCTTGGGGAAGAAAAGG - Intronic
1103926496 12:124426420-124426442 GTTCTTTCTGGGGGCCGTAAGGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1106959445 13:34981037-34981059 ATTATTTATTTGGAGAGTAACGG - Intronic
1108418642 13:50226783-50226805 ATTCTTTCTTTTTGGAGCAAAGG + Intronic
1110205881 13:72912602-72912624 CTTCTCTCTTGGGTAAGTAACGG - Intronic
1111383777 13:87495727-87495749 ATTCTTTCATGGGGGTGCACTGG + Intergenic
1113826464 13:113258365-113258387 GTTCTTATTTGGGGGAGCAAAGG - Intronic
1114388466 14:22280233-22280255 ATTCTTCTTTGAGGGAGGAAAGG - Intergenic
1114509117 14:23242131-23242153 GTTCTTTCTCTGGGGACTAAAGG - Intronic
1119104375 14:71910267-71910289 ATTCTGTCTTTGGGAAGCAAAGG - Intergenic
1119655212 14:76412590-76412612 CTTCTTTGTTGGGGGAGGATGGG - Intronic
1119852922 14:77878920-77878942 ATTCATTCGTGGGGGGGGAAGGG - Intronic
1124911244 15:33922830-33922852 GCTCTTTCTTGGGTGAGGAAGGG + Intronic
1128708072 15:69851765-69851787 ATTCTTTCTGGGAGGAGGAAGGG + Intergenic
1129915259 15:79264576-79264598 ATTCTTTCATGGGTGAGGGAAGG - Intergenic
1130624254 15:85497261-85497283 ATTCTTTCACTGGGGAGGAAGGG + Intronic
1131113057 15:89777104-89777126 ACTGTATCTTGGGGCAGTAAGGG - Exonic
1131581829 15:93650782-93650804 ATCCTTTCTTTGAGGAGTAGAGG + Intergenic
1133648344 16:7785537-7785559 ATTCATTTTTGGGGAAGTGATGG - Intergenic
1133955297 16:10438256-10438278 AGTCTTTTTTAGGGGAGTAGGGG + Intronic
1137645468 16:50069616-50069638 ATTCTTTGTTGGGGAAGGAAGGG - Intronic
1138099442 16:54240680-54240702 CTTCTTTCCTTGGGGAATAATGG - Intergenic
1138959193 16:62008497-62008519 ATTCTTTCTTGGGGGTTTGATGG + Intronic
1140981811 16:80117504-80117526 ATTCTTTCTGGGGCAAGTGATGG - Intergenic
1141136776 16:81470891-81470913 ATCCTTTCTTGGGAAAGAAAAGG + Intronic
1144725750 17:17501515-17501537 ATTGTTTCCTTGGGGAGAAATGG - Intergenic
1146474290 17:33150560-33150582 AGTCTTTCTTGGGGGTGTGGGGG + Intronic
1147127085 17:38378505-38378527 TTTCTTTTTTGGGGGAGACAGGG - Intronic
1150441782 17:65197213-65197235 ATTCTTTCTTGAGGAAGTACTGG - Exonic
1150945982 17:69746013-69746035 ATCTTTTCTTGGAAGAGTAAGGG + Intergenic
1151185307 17:72359867-72359889 ATTCCGTGTTGGGGGAGCAAAGG + Intergenic
1151187976 17:72378082-72378104 TTTCTTTTTTGAGGAAGTAAAGG - Intergenic
1152219925 17:79058052-79058074 ATTCTTTCTTGTGGGGGTTGTGG - Intergenic
1155744976 18:29344353-29344375 TTTTTTTCTTGGTGGAGTATTGG - Intergenic
1157423594 18:47566266-47566288 CTTCATGCTTGGGGGTGTAAGGG + Intergenic
1157716054 18:49888167-49888189 ATTCTTTCTTGGGGGAGTAAGGG + Intronic
1158365807 18:56734338-56734360 ATTCTTTCTTGTTGGAGGACTGG + Intronic
1162782357 19:13012880-13012902 CTTCTCTTTTGGGGGAGTAAAGG + Intronic
1165275989 19:34752075-34752097 ACTCTTTCTAGGGGGAGAAGGGG - Intergenic
1167121943 19:47522454-47522476 ATCCTTTCTTAGTGGAGGAACGG - Intronic
925567881 2:5276255-5276277 TTTCTTACTTGGGGGAGGATTGG + Intergenic
926780498 2:16466804-16466826 GTTCTTTCCTGGGGCAGTATAGG + Intergenic
926983249 2:18593917-18593939 TTTGTTTCTTGGGGGAAAAAAGG - Intergenic
930245256 2:48977267-48977289 AATCATACTTGGAGGAGTAAAGG + Intronic
930322478 2:49874023-49874045 ATTCTTTCTTGAGGCTCTAAGGG - Intergenic
930367783 2:50462905-50462927 ATTCTATTTTGGGGGAGGGAAGG + Intronic
930586756 2:53276421-53276443 ATTCTTTGTTAAGGGAGTAGTGG + Intergenic
934229921 2:90169975-90169997 ATTCTTTCTTGGGGGTAGTATGG + Intergenic
935503919 2:103875168-103875190 AGTTTTTCTTGCTGGAGTAAAGG + Intergenic
935644586 2:105323599-105323621 ATTCTATATTGGGTGAGAAAAGG + Intronic
937132016 2:119520936-119520958 ATTTTTTCTGGGGGTAGGAAGGG - Intronic
940051820 2:149472979-149473001 GTTTTTTCTTTGGGGAGTAGGGG + Exonic
940510888 2:154613235-154613257 CTTCTGTCTTGGGGAAGTTAGGG + Intergenic
941617455 2:167736933-167736955 ATTCTTTTTTTGGGGGGGAAGGG - Intergenic
942555216 2:177165916-177165938 ATTCTTTCTTTGAGGAATTAGGG - Intergenic
943974201 2:194449909-194449931 TTACTTCCTTGGGAGAGTAAAGG - Intergenic
946313145 2:218893882-218893904 ATTCTTGCTGGGGGGAGGCATGG + Exonic
946834386 2:223757701-223757723 ATCTTTTCTTTGGGGAGGAAAGG + Intronic
948420300 2:237855634-237855656 TTTGTTTCTTGGGGGAATAGGGG + Intergenic
1173212960 20:41051468-41051490 ACTCTTTCTTAAGGGAGAAAAGG - Intronic
1174107702 20:48174591-48174613 ATCCTTTCCTGGGGAAATAAAGG - Intergenic
1175608768 20:60332839-60332861 ATTCCTGCTTTGGGGAGAAAAGG + Intergenic
1179344189 21:40540792-40540814 AATATTTGTTGGTGGAGTAATGG - Intronic
1181685401 22:24524477-24524499 TTTCTTTTTTGGTGGAGTAGGGG + Intronic
1183326140 22:37195512-37195534 ATTCTTTCTTGTGCGAGTCCAGG - Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
952923084 3:38300590-38300612 GTTCATTGTTGGGGGAGTAAGGG - Intronic
952956399 3:38560493-38560515 ATTCTTTCTTGGGGTGGCAGGGG - Intronic
953346453 3:42179766-42179788 CTCATTTCTTGGGGGAATAAAGG + Intronic
958659150 3:97043088-97043110 TTTCTTTCCTGGGGGAAAAAAGG - Intronic
960405739 3:117257142-117257164 ATTCTTTTTTGAGAGAGAAATGG + Intergenic
962881299 3:139579176-139579198 ATTCTCTCATGGGGGAGAAAGGG + Intronic
963884441 3:150565215-150565237 GTTCTTTTTTAGGTGAGTAAGGG + Intronic
964572785 3:158128424-158128446 TGTCTTTCTTGGGGGAATGAGGG + Intronic
965496163 3:169401591-169401613 ATTCTGTCTTAGGGTAGAAATGG + Intronic
965988329 3:174784006-174784028 ATTCTTTCTTTGGGAACTATTGG - Intronic
971638801 4:29101399-29101421 ATTTTTTTTTGGGGGGGGAATGG + Intergenic
971747427 4:30601700-30601722 ATGTTTTCTTGGGTGAATAAAGG - Intergenic
971899490 4:32640704-32640726 GTTTTTTGTCGGGGGAGTAAGGG + Intergenic
974333985 4:60515958-60515980 ATTCTTACTTGGGGACTTAATGG + Intergenic
976679320 4:87737826-87737848 ATTCTTTTTTGGGGGAGGGCAGG + Intergenic
976771623 4:88659252-88659274 ATACTCTCTTGGAGGAGCAAGGG + Intronic
977823481 4:101502932-101502954 ATTCTTTCTTGGGGGTTCAGGGG + Intronic
978103565 4:104873676-104873698 ATTTTCTGTTGGGGGAGAAAAGG + Intergenic
978331797 4:107621523-107621545 ATGCATTCTTGGGTGAATAAGGG - Intronic
982077560 4:151753024-151753046 ATTCTTGCTTGGGGGAGGAGGGG + Intronic
983499596 4:168483833-168483855 ATTATTTCTAGGGGGTCTAACGG - Intronic
985043506 4:185916773-185916795 ATTCTTTGTTGGGGGAGGTGGGG - Intronic
986382501 5:7200720-7200742 CTTCTTTCTTGGGAGATTAAGGG + Intergenic
986832241 5:11592720-11592742 ATGCTTTTCTGGGGGGGTAAGGG + Intronic
987920235 5:24271119-24271141 ATTCTTTCTTGTGGTGGTAGGGG - Intergenic
988100032 5:26663339-26663361 TTTCTTTTTGGGGGGAGGAAGGG + Intergenic
988359702 5:30220119-30220141 ATTAATTCCTGGTGGAGTAAAGG - Intergenic
988738961 5:34050705-34050727 GTTCTGGCTTTGGGGAGTAATGG + Intronic
988943773 5:36173633-36173655 GTTCTTTCTTGGAGGAACAAAGG - Intronic
991567993 5:68024767-68024789 ACTCTTTCTCAGGGGAATAATGG - Intergenic
993083798 5:83337836-83337858 CTTCTTTCCTGGAGGAGTCATGG + Intronic
993451985 5:88083102-88083124 TTTCCTTTTTGGGGGAGTGAAGG + Intergenic
993674635 5:90802213-90802235 GTTCTTTTTTGGGGGAGAAGGGG + Intronic
994471013 5:100207148-100207170 ATTCCTTCTTTGTGGAATAAGGG - Intergenic
994994358 5:107040982-107041004 ATTTGTTCTAGGGGAAGTAATGG - Intergenic
997055522 5:130438767-130438789 ATTCTGTCTTGGGCCAGAAATGG - Intergenic
997464829 5:134080247-134080269 AGTCTGTTTTGTGGGAGTAAAGG - Intergenic
997575616 5:134974656-134974678 TTTCCTTCTTGGGGGTGAAAAGG + Intronic
1004014357 6:11718685-11718707 AATCTTTCTTGGGGGATGACTGG + Intronic
1005140877 6:22630137-22630159 ATTCTTTCTTTGGGTCCTAATGG + Intergenic
1006323409 6:33334670-33334692 GTTCTTTCTGAGGGGTGTAAGGG - Intergenic
1007277701 6:40687571-40687593 ATTCTTTCTTGGAGGCTTTAAGG - Intergenic
1007309634 6:40935148-40935170 GTTATTTATTGGGGAAGTAAAGG + Intergenic
1008202225 6:48604577-48604599 ATGCTTTCATGCGGGAATAATGG + Intergenic
1008698227 6:54067164-54067186 AGTCTCTTTTGGGGGATTAATGG + Intronic
1010813962 6:80333007-80333029 ATTCCTTTTTGGGGGAGCTAGGG - Intronic
1013190040 6:107794813-107794835 ATTCCTTCTTGGGGCACTGAGGG + Intronic
1013530364 6:111014044-111014066 TTTCTTGTTTGGGGGAGTAGAGG + Intronic
1015072095 6:129106849-129106871 TTTTTTTTTTGGAGGAGTAAGGG - Intronic
1015079987 6:129211928-129211950 ATTCTTTGTTGAGTGAATAAAGG + Intronic
1016016924 6:139196083-139196105 ATATTTTCTTTGGGGAGGAAAGG + Intergenic
1016053548 6:139554937-139554959 AGTCTCTCTTGGGGGACTGAGGG - Intergenic
1017110063 6:150924072-150924094 AATTCTTCTTGGGGGAGAAAAGG - Intronic
1018557807 6:165066266-165066288 ATTCTTTCATGGGGTGGGAAGGG + Intergenic
1019147446 6:169984393-169984415 ACTCTTTCTAGGGGCTGTAAAGG - Intergenic
1021083204 7:16387987-16388009 TTTCTTTGTTGGGGGAGGCAAGG + Intronic
1022192848 7:28033741-28033763 ACTCTTTTTTGGGGGGGCAATGG + Intronic
1023810653 7:43908698-43908720 ATTCTTTCAAGGGGCAATAAAGG - Intronic
1024310156 7:47961761-47961783 TTTTTTTCTTGGGGGAGACAGGG - Intronic
1026459043 7:70597036-70597058 TTTATTTCTTGGGGGAGCCATGG + Intronic
1027831727 7:83185256-83185278 ATTCTGTCTTGGGGGAGGTGGGG + Intergenic
1028853352 7:95561887-95561909 ATTCTTTCTGGGGGCTGTGAGGG - Intergenic
1028971434 7:96863027-96863049 AGACTTTCTTGGGAGATTAATGG + Intergenic
1029336376 7:99903418-99903440 ATTGTTTCTGGGAGGAGGAATGG - Intronic
1029356796 7:100058029-100058051 AGCCTTACTTGGGGGAGGAAAGG - Intronic
1030139072 7:106286186-106286208 ATTCTATCTGGGGGCAGTGATGG + Intronic
1030377689 7:108772542-108772564 ATGCTTTCTTGGAGGAAAAAAGG - Intergenic
1031994796 7:128222901-128222923 AGTCATTCTTGGGGGAGTTCAGG - Intergenic
1032123134 7:129171229-129171251 ATTCCTTCTTGGGGGCTTCAGGG + Intergenic
1032447526 7:131997445-131997467 ATCCTTTCTTGCTGGAATAATGG + Intergenic
1033388629 7:140904431-140904453 TTTCTTTTTTGGGGGAGGCAGGG + Intronic
1038468421 8:27788671-27788693 ATTTTGTCTTGGGGGAGGGAAGG + Intronic
1041513341 8:58674662-58674684 ATTCTTTCTGGGGACAGTCAGGG - Intergenic
1042239955 8:66653895-66653917 ATTTGTTCTTGGAGGAGGAAGGG - Intronic
1042530423 8:69809169-69809191 ATACTTTTTTGGGGGAGGAAAGG - Intronic
1044355453 8:91217433-91217455 ATTGTGTCTTTTGGGAGTAAAGG + Intronic
1044428791 8:92084669-92084691 ATTCTATCTTTGGGGAGGAAGGG + Intronic
1044806262 8:96011268-96011290 ACTTTTTCTTGGCAGAGTAAAGG - Intergenic
1045799317 8:106083500-106083522 ATACTTTCCTGGGGGCTTAATGG - Intergenic
1045914387 8:107448976-107448998 ACTCATTGTTGGGGGAGTGATGG + Intronic
1046592782 8:116225720-116225742 TTTTGTTCTTGGGGGAGTTAAGG + Intergenic
1047778221 8:128091032-128091054 AGACTTTCCTGGGGGATTAAAGG + Intergenic
1048734148 8:137479630-137479652 ATATTTTCTTGAGGGAGCAAGGG + Intergenic
1049956880 9:701521-701543 ATTCTTTGTTGGGGGAAGGAGGG + Intronic
1050214909 9:3311886-3311908 TTTCTTTTTTGGGGGAGTAGGGG - Intronic
1050788440 9:9435161-9435183 ATTCTTGTTTGGGGGTGTCAGGG - Intronic
1051602415 9:18888614-18888636 ACTCTTTCTTGGTGCAGTGAAGG - Intronic
1051609861 9:18950518-18950540 ATTCTTGCTTGCTGAAGTAAAGG - Intronic
1051790311 9:20794835-20794857 ATTCTGTCTTTTGTGAGTAATGG + Intronic
1052574460 9:30274314-30274336 ATTCCTTCTAGGGAGATTAAGGG + Intergenic
1052911178 9:33883400-33883422 ATTCTTTTAAGGGGGAGTAGTGG - Intronic
1052918300 9:33940771-33940793 TTTGTTTTTTGGGGGAGTACAGG - Intronic
1053753576 9:41280046-41280068 ATTATTTCTTGGGATAGAAAAGG - Intergenic
1054259099 9:62844406-62844428 ATTATTTCTTGGGATAGAAAAGG - Intergenic
1054332680 9:63775631-63775653 ATTATTTCTTGGGATAGAAAAGG + Intergenic
1055710328 9:79054099-79054121 ATTCTGTCTTGGGGAAGACAGGG + Intergenic
1056410485 9:86321371-86321393 TTTTTTTCTTGGCAGAGTAATGG + Intronic
1057402493 9:94737013-94737035 ATTCTTCCTTTGGGTAGTAGTGG + Intronic
1058324380 9:103677436-103677458 ATTCCTTCTTGGGGCACCAAGGG + Intergenic
1059095741 9:111411973-111411995 ATTCTTTTTTGTGGGAGATAGGG - Intronic
1059384363 9:113952533-113952555 ATTCCCTTTTGGGGGAGTTAGGG + Intronic
1059637636 9:116186477-116186499 TTTCTTTCTTTGGGGATAAATGG + Intronic
1202799682 9_KI270719v1_random:163942-163964 ATTATTTCTTGGGATAGAAAAGG + Intergenic
1191696356 X:63994736-63994758 AGTCTTTTTTGGGGGAGTTAAGG - Intergenic
1195761401 X:108250225-108250247 AGTCTTTCTGGTGGTAGTAAAGG + Intronic
1197900866 X:131369758-131369780 ATTGTTTCTTGGGGAAGGAGTGG + Intronic
1198629323 X:138617220-138617242 TATATTTCTTGGGGGAGAAATGG - Intergenic
1198762318 X:140045425-140045447 ATTGTTTCTTGGGAGGGTGATGG + Intergenic