ID: 1157718172

View in Genome Browser
Species Human (GRCh38)
Location 18:49903592-49903614
Sequence GGTCAGGGTGGAGCACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157718172 Original CRISPR GGTCAGGGTGGAGCACACCC TGG (reversed) Intronic
900634791 1:3657735-3657757 GGTCGGGGTTGGGCACAGCCGGG + Intronic
900700486 1:4045624-4045646 GGTCAGGCTGAAGCAGACCTAGG + Intergenic
900882624 1:5392945-5392967 GGTCAGGGTGGATCCCATGCTGG + Intergenic
901496566 1:9625856-9625878 GGTGAGGGTGGAAGTCACCCAGG + Intergenic
901628140 1:10635075-10635097 GGCCTGGATGGACCACACCCAGG - Intergenic
902007478 1:13243764-13243786 GGGCATGGTGGTGCACACCTGGG + Intergenic
902117949 1:14137227-14137249 GGTCAGGCAGGTGCACACCCAGG + Intergenic
903190976 1:21655862-21655884 GGAGAGGGAGGAGCAAACCCTGG + Intronic
903580144 1:24364711-24364733 GGTCAGGCTGGATCAAACCCAGG + Intronic
904094264 1:27965509-27965531 GGTCAGGGTGGGTGACTCCCGGG + Intronic
904297045 1:29526574-29526596 GACCAGAGTGGAGCACACTCTGG - Intergenic
906212658 1:44020806-44020828 CGTCAGGGTGGGGCAGCCCCTGG + Intronic
906381211 1:45333135-45333157 GGTCATGCTGCAGCAGACCCAGG - Exonic
907459079 1:54594521-54594543 GGACAGGGTGGGGGACACTCAGG - Intronic
907847042 1:58218363-58218385 GGTCAGGGTTGAGCCAAGCCAGG + Intronic
910285302 1:85547114-85547136 GGCCGGAGTGGAGAACACCCTGG + Intronic
911791818 1:102026782-102026804 GGTAGGGGTGGAGCAGATCCAGG - Intergenic
913092978 1:115492424-115492446 GGACAGGGAGGAGCACACCAGGG + Intergenic
913158959 1:116128349-116128371 GGGCAGGTTGGAGAAGACCCAGG + Intronic
913958129 1:143321391-143321413 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
914052444 1:144146766-144146788 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
914126753 1:144819775-144819797 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
915726216 1:158019546-158019568 GGTCAGTGTGGAGCTCAGCCTGG - Intronic
918310057 1:183279401-183279423 GCTCAGGGTGGAGCACAGCGTGG + Intronic
918450148 1:184650025-184650047 GGACAAGGAGGAGCAGACCCTGG - Intergenic
920558933 1:206925218-206925240 TGCCAGGCTGGAGCACACCATGG + Intergenic
922763298 1:228145350-228145372 GCTCAGGGGGAAGAACACCCAGG + Intronic
922892954 1:229075615-229075637 GGGAATGGTGGAGTACACCCAGG + Intergenic
1063135009 10:3208699-3208721 GCTCAGGGTGAGGCACAACCAGG - Intergenic
1064550864 10:16499580-16499602 GGTGAGGGTGGTGCACACCCGGG - Intronic
1065612878 10:27489662-27489684 GATCAGGGAGGAGCACACAGGGG + Intergenic
1065773820 10:29101354-29101376 GGTCAGGATGGAGCAGCCACAGG + Intergenic
1066759548 10:38739187-38739209 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1067059055 10:43068455-43068477 GGTCAGGGCGGGGCACAGCTAGG + Intergenic
1069593676 10:69656882-69656904 GGCCTGGGGGGACCACACCCAGG - Intergenic
1070150328 10:73801215-73801237 GAGCAGGGTGGAGCACTTCCTGG + Intronic
1070640990 10:78169780-78169802 CTTCAGTATGGAGCACACCCTGG + Intergenic
1073258811 10:102173278-102173300 GGTCATGATGGTGCAGACCCAGG - Intergenic
1074125783 10:110527936-110527958 GGTCAGGGAGGAACCAACCCAGG - Intergenic
1074491851 10:113945632-113945654 GGTCAGAGGGGAGCAGGCCCTGG - Intergenic
1075729377 10:124627247-124627269 GGCCTGGGTGTGGCACACCCTGG - Intronic
1076541900 10:131220077-131220099 TGCCAGGGTGGAGCTCAGCCCGG - Intronic
1077091851 11:782250-782272 GGACAGGGTGCAGCAGCCCCGGG + Intronic
1077114966 11:879985-880007 GGGGAGGGTGCAGCACACACAGG + Intronic
1077173062 11:1176889-1176911 GGTCAGGCTAGAGCACACACAGG - Intronic
1078068929 11:8095779-8095801 GGTGAGGGTGGGGCACACTTCGG + Intronic
1078428040 11:11267244-11267266 GGTCTGGGAGGAGGAAACCCAGG + Intergenic
1081991932 11:47342716-47342738 GGACGGGGTGGAGCTGACCCGGG - Exonic
1082793064 11:57360579-57360601 GGTCAGGATGGAGACCATCCTGG + Intronic
1083780236 11:64913864-64913886 CGTGAGGGTGGAGCACTCTCCGG - Exonic
1083800996 11:65046171-65046193 GGTCAGGGCTGTGCATACCCAGG + Exonic
1083803037 11:65057802-65057824 GGTCAGGGTGGGGAGAACCCTGG + Intronic
1083934323 11:65862450-65862472 GGCCAGGGTCGAGCACTCCCAGG - Exonic
1084558234 11:69887900-69887922 GGTCTGGGTGGTGCTCAACCAGG - Intergenic
1084734184 11:71093914-71093936 GGACAGGGTGGTGCACGCCCAGG - Intronic
1085054643 11:73396382-73396404 GGTGGGGCTGGAGCACACCTTGG + Exonic
1089396289 11:118138034-118138056 GGTCAGGGTGGAACGCCTCCCGG - Intronic
1089557259 11:119321267-119321289 GGACAGGGTGGAGAAAACCCAGG + Intronic
1090021079 11:123129109-123129131 GGTCAGGTTGGAGACCACGCTGG + Intronic
1090390548 11:126384634-126384656 TGTCTGGGTGTAGCACATCCTGG - Intronic
1091312322 11:134583441-134583463 GGTGAGGTTGGAGCACACAGAGG + Intergenic
1091670654 12:2449869-2449891 GGTGAGGGTGGGGCGCACACAGG + Intronic
1095941097 12:47727392-47727414 TGTCAGAGTGGAGTACAGCCTGG + Intergenic
1095970133 12:47896019-47896041 ATTCAGGGTTGGGCACACCCAGG - Intronic
1096252353 12:50041209-50041231 GGTCAGAATGGAGCCCATCCTGG + Intergenic
1096414282 12:51400116-51400138 GGTCCAGGTGGAACAAACCCAGG - Intronic
1099453341 12:82835000-82835022 GGGCATGGTGGTGCACACTCAGG - Intronic
1100260736 12:92929619-92929641 GGTCAGGGAGGGACACCCCCAGG - Intergenic
1101004076 12:100384718-100384740 CCTCAGGGTGGAGGACAGCCTGG - Intronic
1101949336 12:109162470-109162492 GGACAGGGTGGAAGACTCCCAGG + Intronic
1101962377 12:109259656-109259678 GGTCAGGGAGGGGCAGCCCCAGG + Intronic
1102003887 12:109576248-109576270 GGTCAGGGTAGAAAACACCCGGG - Intronic
1102049715 12:109853951-109853973 GGTCAGGTTGGAGATCAGCCTGG - Intronic
1103483968 12:121270158-121270180 GGTCAGGTTTGAGAACAGCCTGG + Intronic
1103721777 12:122979130-122979152 CGCCACGGTGGAGGACACCCTGG - Exonic
1104302248 12:127575077-127575099 GGAGAAGGTGGAGAACACCCCGG - Intergenic
1104642543 12:130476594-130476616 GGTTAGGGAGCAGCACACACAGG - Intronic
1104860299 12:131919934-131919956 GCTCAGGGTGCAGCAGACACGGG - Intronic
1104969165 12:132523407-132523429 GGTTTGGGAGGAGCACACGCAGG + Intronic
1113388465 13:109873104-109873126 CCTCAGGGTGGAGGCCACCCTGG + Intergenic
1114526216 14:23368256-23368278 GGTGAGGTTGGAGAAAACCCAGG + Intergenic
1115874536 14:37845500-37845522 TGTCAGAGTGGAGCACATACGGG - Intronic
1117435122 14:55708621-55708643 GGTCAGGGTGCAGCATGGCCAGG + Intergenic
1117705510 14:58463172-58463194 GGTCAGGGTAGAGCACTCTAAGG - Intronic
1118400967 14:65379388-65379410 GGGCATGGTGGTGCACACCGTGG + Intergenic
1121333903 14:93065003-93065025 GGTCAGGGGTCAGCACTCCCTGG + Intronic
1121734253 14:96206729-96206751 GGTCAGGGAGGGGCCCACCTGGG + Intronic
1121854126 14:97250975-97250997 GATCAGGGTCTAGCACACCGGGG + Intergenic
1122089830 14:99330833-99330855 GGGCAGGGAGAAGCACAGCCGGG - Intergenic
1122539804 14:102491806-102491828 GGGGAGGGTGGGGCACAACCCGG - Intronic
1122764275 14:104054745-104054767 GGTCAGGCTGGAGAGCAGCCAGG + Intergenic
1122882161 14:104695050-104695072 GGTCCGGGGGGAGGAAACCCAGG + Intronic
1202895573 14_GL000194v1_random:6304-6326 GGTCAGGATTGAGAACAGCCTGG + Intergenic
1202930282 14_KI270725v1_random:28774-28796 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1123422101 15:20142743-20142765 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1123442980 15:20303891-20303913 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1123531329 15:21149283-21149305 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1125008243 15:34841619-34841641 TGGCAGGGTGCTGCACACCCAGG + Intergenic
1128357998 15:66941922-66941944 GGACAGCATGGAGCACAGCCAGG - Intergenic
1129257818 15:74344055-74344077 GGTGAGGGTGGAGGAGTCCCTGG - Intronic
1129986686 15:79924539-79924561 GGTCAGGGTCGAGACCAGCCTGG - Intergenic
1130642022 15:85685757-85685779 GGGCACGGTGGATCACACCCAGG - Intronic
1132583523 16:695834-695856 GCTCAGGCTGGACCACAGCCCGG + Exonic
1134092039 16:11396645-11396667 GGTCGTCGGGGAGCACACCCTGG - Exonic
1135738604 16:24954335-24954357 GGTCAGGGTGTACCACAATCAGG + Intronic
1135786415 16:25353151-25353173 GGTCAAGGTTGAGCTCACCTGGG + Intergenic
1136685304 16:31990498-31990520 GGTCAGGGTGCGGCACAGACTGG - Intergenic
1136718268 16:32301791-32301813 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1136773698 16:32860355-32860377 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1136836642 16:33508061-33508083 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1136862739 16:33712949-33712971 GGGCAGGGTGGAGCAGGTCCAGG - Intergenic
1136883856 16:33919771-33919793 GGTCAGGGTGCGGCACAGACTGG + Intergenic
1136896914 16:34001164-34001186 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1137501702 16:49016595-49016617 GGTCAGGGAGGGGGACACGCAGG + Intergenic
1139356785 16:66371478-66371500 GGTCAGGGAGGAGAGCAGCCAGG + Intronic
1139593695 16:67946631-67946653 GGTCTGTGGGGAACACACCCAGG + Exonic
1140131073 16:72162218-72162240 TCTCAGGGTGGAGCACATGCAGG + Intronic
1140868282 16:79083299-79083321 GGTCAGGGTGAACCACACACTGG - Intronic
1141625537 16:85259286-85259308 GGCCAGGGTGGAGCACAGGGTGG - Intergenic
1141625545 16:85259308-85259330 GGCCAGGGTGGAGCACAGGGTGG - Intergenic
1141925506 16:87166178-87166200 GGTCAGGCTGTGGCACACCGTGG - Intronic
1142315794 16:89344141-89344163 GCTCTGGGAGGAGCACACACGGG + Intronic
1203008160 16_KI270728v1_random:215974-215996 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1203076116 16_KI270728v1_random:1122466-1122488 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1203124222 16_KI270728v1_random:1561108-1561130 GGGCAGGGTGGAGCAGGTCCAGG - Intergenic
1203146827 16_KI270728v1_random:1808362-1808384 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1145900451 17:28487602-28487624 GGACAGGGTGGAGGACACCAGGG + Intronic
1145999512 17:29122832-29122854 GGTCCGGGTAGAGCACCCTCTGG - Intronic
1146163009 17:30570048-30570070 GCTCAGGGTGGGGCAGTCCCAGG - Intergenic
1148342103 17:46879359-46879381 GGTCTGGATGGAGCCCACCAGGG - Intronic
1149971963 17:61227672-61227694 CATCAGGTTGGAGCACACTCGGG + Intronic
1151223468 17:72631285-72631307 GGCCACCGTGGAGCACAACCAGG + Intergenic
1151371157 17:73646976-73646998 GATCAGGGTGGAATCCACCCAGG - Intergenic
1151703391 17:75754777-75754799 GGTGAGGGTGGAGTAGTCCCTGG - Exonic
1151881850 17:76900539-76900561 GGTCGGGGTGGAGCAGCCACGGG + Intronic
1151919123 17:77140809-77140831 GGGGAGGGGGGAGGACACCCGGG - Intronic
1152360370 17:79830565-79830587 ATTCAGGCTGGAGCTCACCCAGG - Intergenic
1152403441 17:80083100-80083122 GGTCTCTGTGGAGCCCACCCTGG - Intronic
1152640912 17:81448854-81448876 GGTCCAGGTGGAGCCCACCCTGG - Intronic
1152711014 17:81870686-81870708 GGTCAGGGAGCAGCACACCCGGG + Intronic
1152928623 17:83099169-83099191 GGTCAGGGAGGAGAGGACCCCGG - Intergenic
1153795442 18:8617738-8617760 GCACAGGGAGGAGCACAGCCGGG + Intronic
1157500771 18:48189071-48189093 GCTCAGGGCTGAGCACACCATGG + Intronic
1157718172 18:49903592-49903614 GGTCAGGGTGGAGCACACCCTGG - Intronic
1160322927 18:77913642-77913664 GGGCATGGTGGTGCACACCTGGG - Intergenic
1160424951 18:78773288-78773310 GGGGAGGGTGCAGCACACCGAGG + Intergenic
1160511151 18:79454262-79454284 GGACAGGGTGGAGCCGACCCTGG - Intronic
1160546642 18:79661317-79661339 GGGCATGGTGGTGCACACCTGGG + Intergenic
1160697004 19:489583-489605 GTTTCGGGTGCAGCACACCCGGG - Intronic
1162792801 19:13071816-13071838 GGGCAGGATGCAGCCCACCCGGG - Intronic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1164633622 19:29777437-29777459 AGTCAGGTTGGAGCCCACCCTGG - Intergenic
1165798798 19:38535153-38535175 CTTCAGGGTGGAGGACACCATGG - Exonic
1167149639 19:47701517-47701539 GGACAGGGAGGAGGACGCCCGGG - Exonic
1167308872 19:48724789-48724811 GGTCAGGGTGCAGCTCGCACTGG + Exonic
1167687151 19:50963455-50963477 AGTCAGGGTGGATCACAGCCCGG + Exonic
1202691842 1_KI270712v1_random:99190-99212 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
925219800 2:2129525-2129547 TGTCAGGCTGGAGCCCACACAGG + Intronic
925579577 2:5397036-5397058 GGGCAGGATGGAGGAGACCCAGG + Intergenic
926767200 2:16331921-16331943 GGCCAGGGAGCAGCCCACCCTGG - Intergenic
927184956 2:20475393-20475415 GGAAAGGGTGGAGCACACTAGGG + Intergenic
928103055 2:28450520-28450542 GATCAGGAAGGAGCCCACCCAGG + Intergenic
928442583 2:31304398-31304420 GCTCAGGGTAGAGCAACCCCCGG + Intergenic
929545271 2:42851413-42851435 GGGCAGGGTTCAGCACCCCCAGG - Intergenic
929938564 2:46313178-46313200 GGTCAGTATGTAGCACAGCCAGG - Intronic
933722808 2:85409247-85409269 GGACAGGCTGGAGCAGCCCCAGG + Intronic
933954548 2:87354766-87354788 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
934238745 2:90250986-90251008 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
934274452 2:91565724-91565746 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
934322868 2:91983536-91983558 GGGCAGGGTGGAACAGGCCCAGG - Intergenic
934461169 2:94214317-94214339 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
934938287 2:98480889-98480911 GGGCAGGGTGCCGCACACTCTGG + Intronic
936145854 2:109980318-109980340 GGGAAGGGTGGAGCAGATCCTGG - Intergenic
936198836 2:110391160-110391182 GGGAAGGGTGGAGCAGATCCTGG + Intergenic
937983859 2:127629867-127629889 GGTCAGGGTGGAGCAGTCCTGGG + Intronic
938492630 2:131772059-131772081 GGTCAGGATTGAGAACAGCCTGG - Intergenic
938936854 2:136134800-136134822 GGTCAGGGAGGAGACCACCATGG - Intergenic
940977433 2:159961699-159961721 AGTGATGGTGGAGCAGACCCAGG - Intronic
944411441 2:199447088-199447110 GGTGACGGTGGAGTTCACCCGGG - Intronic
946418256 2:219551368-219551390 GGGAGGGGTAGAGCACACCCAGG - Intronic
947491048 2:230594458-230594480 GGTCAGGGCGGAGGATTCCCTGG - Intergenic
947791411 2:232871369-232871391 GGTCAAGACTGAGCACACCCTGG - Intronic
947899723 2:233711380-233711402 GGTGAGGGTGGAACACACCTGGG - Intronic
947972106 2:234333193-234333215 GGTTTGGGTGCAGCAAACCCAGG + Intergenic
948923821 2:241081447-241081469 GGTCAGGGCCGAGCACACTGCGG + Intronic
949006363 2:241651117-241651139 GGCCATGCTGGAGCCCACCCTGG + Intronic
1169426650 20:5502253-5502275 GGTCCTGGTGGAGCACTTCCAGG - Intergenic
1171146465 20:22788143-22788165 CTTCAGGATGGAGCACACCAGGG + Intergenic
1172029744 20:31973566-31973588 GGTCAGGGTGGACCTCTCCAAGG + Intronic
1172101660 20:32487424-32487446 GGTCAGGGAAGAGCTCTCCCAGG + Intronic
1172952724 20:38732050-38732072 GGTGAGGATGGAGCCCACCTAGG - Intergenic
1173144273 20:40511352-40511374 GGACAGGGAGGCTCACACCCTGG - Intergenic
1173293064 20:41731268-41731290 GGGCAGGGAAGATCACACCCTGG - Intergenic
1173645245 20:44629229-44629251 GGCCAGGATGGAGCAGACTCAGG + Intronic
1174139946 20:48405791-48405813 GGTCAGGGAGGCACTCACCCAGG + Intergenic
1174499783 20:50976108-50976130 GGGCAGAGTGGAGCCCATCCTGG + Intergenic
1174747357 20:53076663-53076685 GGTGAGGGTGGAGCAGGCCATGG + Intronic
1175967005 20:62664786-62664808 GGTCAGAGTGGGCCAGACCCAGG - Intronic
1176008615 20:62880194-62880216 GGTCAGAGAGGACCACCCCCTGG - Exonic
1176063483 20:63182416-63182438 GGCCAGGGTGGGGCCCAGCCCGG + Intergenic
1176122319 20:63459582-63459604 GGACAGGGTGGGGCACACGATGG + Intronic
1176302187 21:5103927-5103949 GGTCAGGTCAGAGCCCACCCTGG - Intergenic
1176380860 21:6111498-6111520 GGTCAGGTTGGAGCCGACCGCGG + Intronic
1176592294 21:8657356-8657378 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1176709927 21:10141664-10141686 GGTCAGGATTGAGAACAGCCTGG - Intergenic
1176866373 21:14057011-14057033 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1177076439 21:16580892-16580914 GTTCAGTGTGGGGAACACCCAGG + Intergenic
1179742612 21:43426742-43426764 GGTCAGGTTGGAGCCGACCGCGG - Intronic
1179854841 21:44157995-44158017 GGTCAGGTCAGAGCCCACCCTGG + Intergenic
1180080937 21:45487264-45487286 GGCCTGGGTGGAGCCCCCCCGGG - Intronic
1180275145 22:10634485-10634507 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1180549618 22:16529419-16529441 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1180959762 22:19757220-19757242 CGTCAGGGTGGAGGAAACCCTGG - Intronic
1181541158 22:23574002-23574024 GGCCAGGCTGGGGCACAGCCTGG - Intronic
1181802359 22:25355944-25355966 CTTCAGGGTGGGGAACACCCAGG - Intronic
1183295666 22:37027925-37027947 GGGCAGGGAGGAGTAAACCCAGG - Intronic
1183585469 22:38750744-38750766 GGCCAGGCTGGGGCGCACCCAGG + Intronic
1184236219 22:43184555-43184577 GCCCAGGGTGGAGCAAACCAGGG + Intronic
1184454406 22:44600989-44601011 GGTCAGGGTTGAGCTGACGCAGG - Intergenic
1184508981 22:44921112-44921134 GGGCAGGTTGGTGCACACCCAGG - Intronic
1184511536 22:44936239-44936261 GGCCAGGGAGGAGCACTCCAGGG - Intronic
951865701 3:27304865-27304887 GGTCAGAGTGGAGCAGACTGAGG + Exonic
954517383 3:51190813-51190835 GGTCAGGTAGGTCCACACCCTGG + Intronic
954601911 3:51876763-51876785 GCTCAGGGTGGAGCAGAGCTGGG - Intergenic
954957876 3:54538014-54538036 GTGCAGGGTGGAGCACTCCTGGG - Intronic
955340809 3:58123623-58123645 GGTCAAGGTGGAGCCCGCCGTGG + Exonic
956075234 3:65498002-65498024 GGTCAGGTTGGCCCAGACCCAGG - Intronic
959735639 3:109654997-109655019 CTTCAGGGTGGAGCCCTCCCAGG - Intergenic
959847749 3:111054292-111054314 GGACATGGTGGGGCACACCTTGG + Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961011964 3:123442417-123442439 GGTGTGGCTGGAGCACACGCAGG - Intronic
962363804 3:134763735-134763757 GGTCAGAGTGGGGGACACCAAGG - Intronic
964010389 3:151885533-151885555 GGACTGGGTGGAGCCCACCGCGG + Intergenic
965834126 3:172832109-172832131 GGTCAGGGAGGAGCACAGAGCGG + Intergenic
967113612 3:186317579-186317601 GGGCAGGGTGGAGGACATCATGG - Intronic
968593370 4:1470801-1470823 GGTCAGGATGGAGCAGGTCCAGG - Intergenic
969435902 4:7189282-7189304 GTTCAGGGAGGAGCAGACGCAGG - Intergenic
969662396 4:8537924-8537946 GGTCATTGTGGATCAGACCCCGG + Intergenic
972072425 4:35038414-35038436 GGGCAGAGTGGATCACTCCCCGG - Intergenic
975628308 4:76372302-76372324 GGCCATGGTGGTGCACACCTGGG + Intronic
978319852 4:107481598-107481620 AGGCAGGGTGAAGCACACCAAGG + Intergenic
978382556 4:108144788-108144810 GCTCAGTGTGCAGCAAACCCAGG + Intronic
978987301 4:115029082-115029104 AGTCAGGGTGCAGCAATCCCAGG + Intronic
980844752 4:138311186-138311208 TGTCAGTGTGGCACACACCCAGG + Intergenic
983949437 4:173622302-173622324 GGACAGAGTGGAGCCCACCGCGG - Intergenic
985359625 4:189158935-189158957 GGTGAAGGGGGAGCAAACCCAGG + Intergenic
985471421 5:49565-49587 GGTCAGGGTACAGCACTTCCGGG + Intergenic
985471432 5:49604-49626 GGTCAGGGTACAGCACTTCCGGG + Intergenic
985471445 5:49649-49671 GGTCAGGGTACAGCACTTCCGGG + Intergenic
985822367 5:2169032-2169054 GATCGGGGTGGGCCACACCCAGG + Intergenic
986168414 5:5295673-5295695 GGGCAGGGAGGAGCCCATCCAGG + Intronic
986306651 5:6521487-6521509 GGTCAGGGTGGCGCAGCCGCAGG + Intergenic
986415716 5:7526050-7526072 GGACAGGGAAGAGGACACCCAGG - Intronic
988046596 5:25963353-25963375 AGCCAGGTTGGTGCACACCCTGG + Intergenic
990332602 5:54742512-54742534 CGTGTGGGTGGAGCACCCCCAGG - Intergenic
995402472 5:111757868-111757890 GGCCAGGGTGCTGCACAGCCCGG + Intronic
1001518032 5:172370524-172370546 GGGTTGGCTGGAGCACACCCCGG + Intronic
1001696797 5:173676206-173676228 GGTCATGGTGGAGCTTCCCCAGG + Intergenic
1001954196 5:175837196-175837218 GGTCAGGGGGAAGCACAGCTTGG - Intronic
1002136863 5:177113007-177113029 GGCCGGTGTGGAGCACACCAGGG - Intergenic
1002198248 5:177512758-177512780 GGTCAGGGTGGTGCAAGCACTGG - Exonic
1002298783 5:178246188-178246210 GGTCATGGTGGCGCTCAGCCCGG - Intronic
1003625213 6:7735129-7735151 GGTCAGGGTGGAGCGGGCTCCGG - Intronic
1014307349 6:119758637-119758659 GCTGAGGGTGGGGCACAGCCTGG + Intergenic
1015008958 6:128320112-128320134 GGCCAGGCTGGAACTCACCCAGG + Intronic
1017239671 6:152153310-152153332 GGTAAGGTTGGAGTACCCCCAGG + Intronic
1017992763 6:159505338-159505360 GGCTGGGGTAGAGCACACCCAGG - Intergenic
1018903882 6:168064189-168064211 GGTCAGGGTGGGGCCCAGCCAGG - Intronic
1018923132 6:168189554-168189576 GGGCAGCATGGAGCACACACAGG + Intergenic
1019682041 7:2355633-2355655 GGACAGGGTGGAGCTCACTTCGG + Intronic
1028931928 7:96422853-96422875 ACTCAGGGTGGAGCACACAGAGG + Intergenic
1028985529 7:97005924-97005946 GGGGAGGGTGGAGGAAACCCGGG + Exonic
1029150731 7:98478570-98478592 GGTCATGGGGCAGCACCCCCAGG + Intergenic
1032337917 7:131043409-131043431 GGTCAGGTGGGTGGACACCCAGG + Intergenic
1034196557 7:149252774-149252796 GGTCCTGGTGGTGCCCACCCAGG + Exonic
1034453105 7:151148433-151148455 AGTCTGGGAAGAGCACACCCAGG + Intergenic
1034497264 7:151430483-151430505 GGAGAGGTTGGAGGACACCCAGG + Intronic
1035952970 8:4044657-4044679 GGCCAGGGTGGTACACGCCCAGG - Intronic
1037882462 8:22579710-22579732 GGGCAGGGTGGTGCCCAGCCTGG + Intronic
1038404105 8:27309166-27309188 GGTCAGGGCTGAGAACACCCAGG - Intronic
1040020605 8:42737506-42737528 GGTGGGGGTGAAGCCCACCCAGG - Intergenic
1041109674 8:54472638-54472660 GGTCTGGGTGGAGGTCACTCGGG + Intergenic
1043527557 8:81112529-81112551 TGTCTGGGTGGGGCCCACCCAGG + Intergenic
1047447012 8:124928458-124928480 GGTCAGGGTGGAGCGCAGAGAGG + Intergenic
1048975890 8:139672862-139672884 GGGCAGGGTGGAACCCACGCAGG - Intronic
1049741884 8:144244883-144244905 GGACAGGGTGGAGGCCACCTTGG - Intronic
1051519589 9:17970696-17970718 GGTCAAGGGGGAGCAGAACCAGG - Intergenic
1053691665 9:40589994-40590016 GGGCAGGGTTGAGCAGGCCCAGG - Intergenic
1054273137 9:63047491-63047513 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1054302921 9:63390960-63390982 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1054327908 9:63725316-63725338 GGTCAGGATTGAGAACAGCCTGG - Intergenic
1054401702 9:64717476-64717498 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1054435305 9:65201785-65201807 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1054495085 9:65819896-65819918 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1056910713 9:90697757-90697779 TGTCATTGTGGAGCACACACTGG + Intergenic
1058955256 9:109940917-109940939 GGGCAGGATGGAGCACAGGCTGG + Intronic
1059034773 9:110742241-110742263 GGTCAGGATGGAGACCATCCTGG + Intronic
1060247294 9:121957455-121957477 GCTCTGGGCTGAGCACACCCAGG + Intronic
1061883232 9:133578338-133578360 GGTCAGGGCGGAGCATCCCAAGG + Intergenic
1062457125 9:136645105-136645127 GGTCAGGCCCCAGCACACCCGGG + Intergenic
1202794690 9_KI270719v1_random:110661-110683 GGTCAGGATTGAGAACAGCCTGG - Intergenic
1203622348 Un_KI270749v1:136203-136225 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1188981937 X:36734465-36734487 GGTGAAGGTGCAGCTCACCCAGG - Intergenic
1192168054 X:68838366-68838388 CGGCAGGGTGGAGCACTGCCTGG - Intronic
1192203758 X:69082928-69082950 TGTCTGGGTGGAGCACATCTGGG - Intergenic
1192738037 X:73867286-73867308 GGTCAGGTTGGAGACCAGCCTGG - Intergenic
1200082162 X:153583044-153583066 GGCCAGGCTGCTGCACACCCAGG - Intergenic
1201190360 Y:11438703-11438725 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1201902046 Y:19053472-19053494 GCTCAGGCTGGAGCACACAGAGG - Intergenic
1202583260 Y:26403201-26403223 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic