ID: 1157718592

View in Genome Browser
Species Human (GRCh38)
Location 18:49906391-49906413
Sequence TGCCCTGAGCTGCCACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 238}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157718585_1157718592 2 Left 1157718585 18:49906366-49906388 CCCCATCTTCCCCACCATGATCT 0: 1
1: 1
2: 3
3: 46
4: 372
Right 1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG 0: 1
1: 0
2: 4
3: 16
4: 238
1157718589_1157718592 -8 Left 1157718589 18:49906376-49906398 CCCACCATGATCTGCTGCCCTGA 0: 1
1: 0
2: 1
3: 14
4: 175
Right 1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG 0: 1
1: 0
2: 4
3: 16
4: 238
1157718588_1157718592 -7 Left 1157718588 18:49906375-49906397 CCCCACCATGATCTGCTGCCCTG 0: 1
1: 0
2: 2
3: 23
4: 231
Right 1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG 0: 1
1: 0
2: 4
3: 16
4: 238
1157718584_1157718592 3 Left 1157718584 18:49906365-49906387 CCCCCATCTTCCCCACCATGATC 0: 1
1: 1
2: 12
3: 114
4: 1018
Right 1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG 0: 1
1: 0
2: 4
3: 16
4: 238
1157718586_1157718592 1 Left 1157718586 18:49906367-49906389 CCCATCTTCCCCACCATGATCTG 0: 1
1: 0
2: 1
3: 16
4: 196
Right 1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG 0: 1
1: 0
2: 4
3: 16
4: 238
1157718590_1157718592 -9 Left 1157718590 18:49906377-49906399 CCACCATGATCTGCTGCCCTGAG 0: 1
1: 0
2: 2
3: 26
4: 279
Right 1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG 0: 1
1: 0
2: 4
3: 16
4: 238
1157718583_1157718592 25 Left 1157718583 18:49906343-49906365 CCAAGTAGCTGAGAAAGGCAGAC 0: 1
1: 0
2: 2
3: 34
4: 338
Right 1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG 0: 1
1: 0
2: 4
3: 16
4: 238
1157718587_1157718592 0 Left 1157718587 18:49906368-49906390 CCATCTTCCCCACCATGATCTGC 0: 1
1: 0
2: 1
3: 27
4: 346
Right 1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG 0: 1
1: 0
2: 4
3: 16
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157718592 Original CRISPR TGCCCTGAGCTGCCACAGTC TGG Intronic
900529824 1:3147722-3147744 TACCCTGGGCGGCCTCAGTCAGG + Intronic
900604108 1:3516223-3516245 TGCCCTGAGCTGGCGCAGGGAGG + Intronic
901124042 1:6916885-6916907 TGCCGTGAGCTTCCACTGTAGGG + Intronic
901644804 1:10710604-10710626 AGCCCTGAGCTGGCAGAGACTGG - Intronic
901665686 1:10824937-10824959 TGCCCTGAGGCACCACAGTCTGG + Intergenic
902326408 1:15703687-15703709 TGCTCTGAGCTGCCACAGCCCGG - Intronic
903187805 1:21639177-21639199 TGCCCTGAGCTGCCCCAGGCTGG + Intronic
903579414 1:24359604-24359626 TGCCCCCAGAGGCCACAGTCAGG - Intronic
904163447 1:28537688-28537710 TTCCCTGAACTCCCAGAGTCTGG + Intronic
905225832 1:36478597-36478619 TGCCCTGACCTCCCAAAGTATGG - Intronic
905535666 1:38719919-38719941 TGCCCTGAGCTCCCTCAGTTTGG - Intergenic
905807022 1:40884519-40884541 GGTCCTGAGCTGCCCCAGGCTGG - Intergenic
905850774 1:41273044-41273066 GGGCCTGAGCTGCCACATGCAGG + Intergenic
909987150 1:82175001-82175023 TGCTCTGACCTGCTCCAGTCTGG - Intergenic
912704778 1:111903922-111903944 TGGACTGAGCTCCCTCAGTCTGG - Intronic
915162550 1:153930557-153930579 TGCCCAGAGCAGCCATTGTCAGG + Exonic
915596742 1:156900621-156900643 TTCACTGAGCTGCGACAGGCAGG - Intronic
917501087 1:175585904-175585926 AGCCCTGAGCAGCCTAAGTCTGG - Intronic
918056349 1:181024940-181024962 TTGCCTGAGATGCAACAGTCAGG - Intergenic
918180509 1:182082929-182082951 TGCCCTCAGCTCCCACTGGCTGG + Intergenic
920654974 1:207868347-207868369 TGCCCAGAACTGCCCCAGGCCGG - Intergenic
1062973412 10:1665643-1665665 TTCCCTGAGCTGCCTCAGAATGG - Intronic
1067103334 10:43349121-43349143 TGACCTGAGCTGAGACAGGCAGG + Intergenic
1067716184 10:48692717-48692739 AGCCCTTGGCTGGCACAGTCAGG - Intronic
1067834159 10:49627884-49627906 GGCCCTGAGCTCCCACACTATGG - Intronic
1069526919 10:69180489-69180511 GGCCCTGAGGTTTCACAGTCAGG - Exonic
1069840673 10:71337483-71337505 TGCCTTGAGCTGCCACCCCCAGG + Intronic
1072787437 10:98293817-98293839 TGCCATGAGCTGCCACTCTGAGG - Intergenic
1073189335 10:101639686-101639708 AGCCATGAGCTGCCAAACTCAGG + Intronic
1075091351 10:119445719-119445741 TGTCCTGAGCTGCCACCAGCTGG - Intronic
1077673905 11:4181138-4181160 TGCCCTGATCTGCCTGAGCCTGG + Intergenic
1080639299 11:34149474-34149496 TGCTATGAGCAGCCACAGGCAGG - Intergenic
1081582905 11:44364837-44364859 AGCCCTCAGGTGCCACAGCCAGG - Intergenic
1081657332 11:44866117-44866139 TGCCCTCTGCTGCCACACTCGGG + Intronic
1083151691 11:60795619-60795641 TGCCCACAGCTGTCACAGCCTGG + Exonic
1083682867 11:64359303-64359325 TGCCCCGGGCAGCCGCAGTCAGG - Intronic
1084490897 11:69477755-69477777 AGCCCCAAGCTGCCACAGCCTGG + Intergenic
1085810072 11:79671972-79671994 TGCCCGAGGCTGCCACTGTCAGG + Intergenic
1086414640 11:86576528-86576550 TGCCCTGAGCTTGCTCAGGCAGG - Intronic
1088811887 11:113397761-113397783 GGCCCTGAGCTGCCTCTTTCTGG + Intronic
1090865539 11:130697663-130697685 TGGCCTGGGCTCCCTCAGTCTGG + Intronic
1091719307 12:2801073-2801095 AGCCCTGAGCTCCCACAATGTGG + Intronic
1093785564 12:23188206-23188228 TTCCCTGAGATGAGACAGTCAGG - Intergenic
1095513558 12:42980287-42980309 AACCCTGAGTTGCCACAGACTGG - Intergenic
1095782067 12:46071507-46071529 TGCCCTGACTTGCCACAGGGTGG + Intergenic
1101325652 12:103713314-103713336 TGTCCAGTGCTGCCACAATCTGG - Intronic
1103942862 12:124510368-124510390 TGCCCTGAGCAGCCACGGGAGGG + Intronic
1105503444 13:20991101-20991123 TGCCCTGCCCTGACAGAGTCAGG - Intronic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1107556455 13:41520250-41520272 AGCCCTGAGTTGGCACAATCTGG + Intergenic
1107832211 13:44384561-44384583 TGCCCTGGCCTGCAACACTCAGG + Intronic
1110505266 13:76278718-76278740 TGCCCTGAGGTGTCAGAGTCAGG - Intergenic
1112847739 13:103664763-103664785 AGCCATGTGCTGCCACATTCAGG - Intergenic
1114141616 14:19917725-19917747 TGCCTTTTGCTGCCACAGTCAGG - Intergenic
1114263795 14:21058988-21059010 CACCCTGAGCAGGCACAGTCTGG + Intronic
1115537490 14:34386778-34386800 TGACTTGAGCTGCCAGAGTGAGG - Intronic
1118725491 14:68625906-68625928 TCCCCTGAGTGGCCACAGTGTGG + Intronic
1119893407 14:78200031-78200053 TGCCAGGAGCTGTCACAATCTGG - Intergenic
1120691728 14:87600397-87600419 TGCCCATAGCAGCCACACTCAGG + Intergenic
1122286951 14:100658050-100658072 TGCCCCGAGGAGCCACTGTCTGG + Intergenic
1122358147 14:101136586-101136608 GGCCATGAGCTCCCACAGACAGG - Intergenic
1123060274 14:105591274-105591296 TGCCCTGAGCTGCCCTGGCCTGG - Intergenic
1123084753 14:105712265-105712287 TGCCCTGAGCTGCCCTGGGCTGG - Intergenic
1202840189 14_GL000009v2_random:114346-114368 TGCCCTGAGCTTGCACAAACCGG - Intergenic
1202909572 14_GL000194v1_random:104543-104565 TGCCCTGAGCTTGCACAAACTGG - Intergenic
1124378409 15:29143474-29143496 TGCCCTGACCTCCCACAGGAAGG - Intronic
1124398850 15:29331048-29331070 GCCCCTGAGCTGCCACTGCCAGG + Intronic
1125130186 15:36275512-36275534 TGCCCTGAGCTGCCAGCATAAGG - Intergenic
1127283579 15:57513165-57513187 TGCCCTGGGCTGCTACAGGGAGG - Intronic
1127333986 15:57965882-57965904 TGCCCTGAGCTGGCATTGGCCGG - Intronic
1127867134 15:63042339-63042361 CGCCCTGAGCTGCCGGAGGCCGG - Intergenic
1129603925 15:77015669-77015691 TGCTCTGAGCTGGGACAGTCAGG - Intronic
1130538293 15:84802522-84802544 TGCCCTGAGCTGCCAGTGCTGGG + Exonic
1131449528 15:92527875-92527897 GGACCTGGACTGCCACAGTCAGG + Intergenic
1132152980 15:99475467-99475489 TGTCCTGAGCTCCCACTGTGTGG + Intergenic
1132621644 16:870656-870678 AGCCCTGACCAGCCACATTCAGG - Intronic
1134065962 16:11228421-11228443 AGCTCTGACCTGGCACAGTCAGG - Intergenic
1134689061 16:16179025-16179047 TGCCCTGACCTGCCACAGCCTGG - Intronic
1135355901 16:21768746-21768768 TGCCCAGAGATGCCACTCTCTGG - Intergenic
1135454391 16:22584885-22584907 TGCCCAGAGATGCCACTCTCTGG - Intergenic
1137512326 16:49112454-49112476 TGCCCTGACCTGCCTCAGAGTGG - Intergenic
1138446491 16:57067452-57067474 TGACCTGAGCTGCTGCAGCCTGG - Exonic
1139964347 16:70737258-70737280 TGCCCTGAGCTGCCCCGTCCCGG - Intronic
1141663111 16:85452383-85452405 TGCCCTGAGCTGCCAGACAGAGG - Intergenic
1141975880 16:87516154-87516176 TGCCCTGAGCTACGTCAGCCCGG + Intergenic
1142120603 16:88384730-88384752 TGCCCAGAGCTGCCAGCCTCGGG - Intergenic
1142238453 16:88934270-88934292 TGACCTGAGCAGCCACTGTGGGG - Intronic
1145797550 17:27664545-27664567 TGCCCTGAGGACCCAAAGTCTGG - Intergenic
1147602934 17:41757067-41757089 TCCCCTGAGCTGCTCTAGTCCGG - Intronic
1147665847 17:42147509-42147531 GGCCCTGACTAGCCACAGTCCGG - Intronic
1148172559 17:45534930-45534952 TGCCCAGAGCTGGTACAGCCAGG + Intergenic
1148276711 17:46310520-46310542 TGCCCAGAGCTGGTACAGCCAGG - Intronic
1148298828 17:46528108-46528130 TGCCCAGAGCTGGTACAGCCAGG - Intronic
1148363360 17:47032605-47032627 TGCCCAGAGCTGGTACAGCCAGG - Intronic
1150123397 17:62621367-62621389 TGCCCTGAGGCGCCGCAGTAAGG - Intergenic
1150403763 17:64881853-64881875 TGCCCAGAGCTGGTACAGCCAGG + Intronic
1151296381 17:73189507-73189529 AGACCTCAGCTGCCACAGCCGGG - Intergenic
1151698357 17:75729651-75729673 TGGCCTGAGCAGTCACAGCCTGG + Intronic
1152008611 17:77697264-77697286 TGCTCTGAGCTGCTGCAGACGGG + Intergenic
1153299527 18:3580888-3580910 TGCCCTGAGCTGCCAGTGCTGGG + Intronic
1153910223 18:9700199-9700221 TGCCCTGATGGGCCACAGACAGG - Intergenic
1154028293 18:10727011-10727033 TGCTCTGTGCTTCCACGGTCTGG + Intronic
1156647852 18:39188258-39188280 TGACTTGAGCTGCCTCAGTTGGG + Intergenic
1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG + Intronic
1158204322 18:54974905-54974927 GGCCCTGAGCGTCCACACTCAGG - Intergenic
1161092983 19:2372103-2372125 TGCCTTGACCTCCCAAAGTCTGG + Intergenic
1161378930 19:3954313-3954335 AGCCCTCAGCTCCCACAGGCTGG - Intergenic
1161664382 19:5565948-5565970 TTCCCAGAGCTGCCCCAGGCCGG + Intergenic
1163268038 19:16233322-16233344 GGCCCTGTGCTGCCCCAGGCTGG - Intronic
1163831391 19:19548674-19548696 TGCCCTGAGCTGACCCAGGGTGG - Intergenic
1164472946 19:28550976-28550998 TGCGATGCTCTGCCACAGTCAGG - Intergenic
1164771575 19:30813661-30813683 TGCCATGAGCTGCCTCTGTCTGG + Intergenic
1165374851 19:35434478-35434500 TGCCCTGAGCTGTCAGAGATGGG - Intergenic
1165398265 19:35579888-35579910 TGTCTTGAGATGCCACTGTCTGG - Intergenic
1166122584 19:40694288-40694310 TGCCCTGAGCTCCCACCCCCAGG + Intronic
1166659441 19:44636637-44636659 AGCACTGAGCTCCCACAGACAGG - Exonic
1167268662 19:48496006-48496028 GGCCCTGAGCTGCCCAAGGCTGG - Intronic
1167288401 19:48611799-48611821 TCCCCTGAGCTGCGACACTGCGG + Intronic
1167538204 19:50068882-50068904 TGCCTCTAACTGCCACAGTCAGG + Intergenic
1167868604 19:52348886-52348908 TGGACTGAGCTGCCCCATTCAGG - Intronic
1202632855 1_KI270706v1_random:16211-16233 TGCCCTGAGCTTGCACAAACTGG + Intergenic
1202653023 1_KI270707v1_random:23838-23860 TGCCCTGAGCTTGCACAAACCGG - Intergenic
1202659132 1_KI270708v1_random:51907-51929 TGCCCTGAGCTTGCACAAACCGG + Intergenic
926797709 2:16632426-16632448 TCCCCTGAGGTGGCACAGACAGG - Intronic
927092900 2:19726008-19726030 GGCCCTGAGCTGCCTGAGTGTGG - Intergenic
928432720 2:31234199-31234221 TCCCCTGAGCCGCCTCGGTCCGG + Intergenic
930156510 2:48112165-48112187 TGCCCAGGGCTGCGATAGTCCGG - Intergenic
930750424 2:54929057-54929079 TCCTGTCAGCTGCCACAGTCAGG - Intronic
933811467 2:86035393-86035415 AGTCCTGACCTGCCACAGACTGG + Intronic
935071232 2:99695572-99695594 TGCCCACAGCCACCACAGTCAGG + Intronic
941559620 2:167028334-167028356 TGTCCTGAGCTGCCTGAATCAGG - Intronic
941732612 2:168934993-168935015 TGACCTGGGCTGACTCAGTCAGG - Intronic
942018471 2:171841879-171841901 TGCAGTGAGCTTACACAGTCTGG + Intronic
942366794 2:175236638-175236660 TGCCCTGTGAGGCCACAGTGTGG + Intergenic
944133263 2:196370095-196370117 TCCCCTTAGCTGCCACAGCTGGG + Intronic
944935506 2:204563131-204563153 TGCCCTGGGCTGCCAGAAGCTGG - Intronic
1170864044 20:20137443-20137465 TGCCTAGTGCTGTCACAGTCAGG - Intronic
1171116543 20:22529745-22529767 TGCCCTGTGTTCCCAGAGTCAGG + Intergenic
1171425504 20:25046310-25046332 TGTCCTTAGCTTCCACAGGCTGG + Intronic
1172098004 20:32470026-32470048 GGCCCTGACCTGCCCCAGCCAGG + Intronic
1172169101 20:32918158-32918180 TGCCCTGAGTACCCACAGGCAGG - Intronic
1173231319 20:41201115-41201137 TGGCATGAGCTGCCTCAGTGTGG - Intronic
1174042852 20:47712365-47712387 TGACCTGAGGTGCCACGGTGAGG - Intronic
1174298664 20:49567362-49567384 TCCCCTGAGGTCCCACAGCCTGG - Intronic
1174417503 20:50377126-50377148 TGCCCTGAGGCAGCACAGTCAGG + Intergenic
1174549309 20:51350203-51350225 TGCCCTGCTCTGCCACTGGCTGG + Intergenic
1175869786 20:62203248-62203270 TCCCCAGAGCAGCCACAGTCAGG - Intronic
1176018367 20:62950129-62950151 TGCCTTGAGCTGCCCGTGTCAGG + Intergenic
1176599128 21:8775813-8775835 TGCCCTGAGCTTGCACAAACCGG + Intergenic
1176645074 21:9342091-9342113 TGCCCTGAGCTTGCACAAACTGG + Intergenic
1178318293 21:31585432-31585454 TGTCCTGAGCTGTCTCAGTCAGG - Intergenic
1180004762 21:45015254-45015276 TGCCCTGAGCTGCCCAGCTCTGG + Intergenic
1180096281 21:45556676-45556698 TGGCCGGAGCTGCCACAGACAGG + Intergenic
1180326591 22:11435431-11435453 TGCCCTGAGCTTGCACAAACCGG + Intergenic
1180367879 22:11957143-11957165 TGCCCTGAGCTTGCACAAACTGG - Intergenic
1180378210 22:12114193-12114215 TGCCCTGAGCTTGCACAAACTGG + Intergenic
1180419299 22:12799088-12799110 TGCCCTGAGCTTGCACAAACCGG - Intergenic
1181943822 22:26499513-26499535 TCCCAACAGCTGCCACAGTCTGG - Exonic
1182310894 22:29405693-29405715 TGCCCAGAGTTACCACAGTGAGG - Intronic
1182529679 22:30945583-30945605 TGCCCTGATCTCCCACAATGAGG + Intronic
1182690159 22:32155065-32155087 TGCCCAGAGTTACCACAGTGAGG + Intronic
1183650121 22:39148926-39148948 TGCCCAGAGCTGCTGCTGTCGGG - Intronic
1184252012 22:43266178-43266200 TGCCCTGAGATGCCCCAGTCAGG + Intronic
1185103782 22:48855889-48855911 GGCCATGAGCTGCCACTGCCTGG + Intergenic
949488841 3:4567850-4567872 TGCCCTGGACTTCCACAGTGTGG + Intronic
950444557 3:13028850-13028872 TGCCCTGAGGTCACACAGTAAGG + Intronic
950491208 3:13306055-13306077 TCCCCTCAGCTGCCACAGAGGGG + Intergenic
952056809 3:29457092-29457114 TGGCATGAGTTGACACAGTCAGG + Intronic
953249948 3:41236061-41236083 TGACCTGGGCTGCCAGAGGCAGG + Intronic
953336664 3:42099404-42099426 TGCTCTGAGCTGCCGCACTCAGG - Intronic
954426210 3:50444443-50444465 AGCCCTGAGCTACCTCAGCCAGG + Intronic
954913352 3:54127782-54127804 TGCCCTGCTCTGCTACTGTCTGG - Intronic
956751736 3:72348845-72348867 TGCCCTGGCCTGCCAACGTCAGG - Intergenic
957095250 3:75771953-75771975 TGCCCTGAGCTTGCACACACCGG - Intronic
957680429 3:83426497-83426519 TGTCATGTGGTGCCACAGTCTGG - Intergenic
961213684 3:125143780-125143802 TGCCCTGACATCCCCCAGTCTGG - Intronic
961591504 3:127985027-127985049 TGCCCTGGGCTGACTCTGTCCGG + Exonic
961752420 3:129104671-129104693 TGCCCATCGCTGCCTCAGTCGGG + Intronic
962216698 3:133528739-133528761 TGCCCTGGCCTCCCAAAGTCTGG - Intergenic
962606284 3:137035360-137035382 TGCCCTCAGCTGCTAGAGCCTGG - Intergenic
963658440 3:148090429-148090451 AGCCCTGTGCAGCCCCAGTCAGG + Intergenic
964444436 3:156744007-156744029 TGCCCAGAGCTGCCACACACAGG - Intergenic
1202741817 3_GL000221v1_random:62977-62999 TGCCCTGAGCTTGCACAAACTGG - Intergenic
968975242 4:3818867-3818889 TATCCTGAGCAGCCACAGTGGGG - Intergenic
969457343 4:7307538-7307560 AGCCCTGACCTGCCCCAGCCTGG - Intronic
969462444 4:7335906-7335928 TGACCTGAGCTGCCAGGGTTAGG + Intronic
969514756 4:7640823-7640845 TTCCCTGACCAGCCACAGTTTGG - Intronic
973362489 4:49178185-49178207 TGCCCTGAGCTTGCACAAACCGG + Intergenic
973398612 4:49618676-49618698 TGCCCTGAGCTTGCACAAACTGG - Intergenic
980013557 4:127623139-127623161 TGCCCCGAGCTCCCACAGCGAGG + Intergenic
982087505 4:151851148-151851170 TCCTCTGAGCTGCCTCAGGCAGG + Intergenic
985089472 4:186348622-186348644 AGCACTGAGCTGCCACAGCTGGG + Intergenic
1202759829 4_GL000008v2_random:99658-99680 TGCCCTGAGCTTGCACAAACTGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
991631579 5:68661428-68661450 TGCCCTCAGCTGGCCCAGTCAGG + Intergenic
992179941 5:74185858-74185880 TTCCCTGAGGTTCCACTGTCTGG - Intergenic
994685782 5:102949961-102949983 AGCCCTCAGCTGCCACAGGTGGG + Exonic
997225295 5:132205175-132205197 TACCCTGAGCTTCCACAGGATGG - Intronic
997602456 5:135149907-135149929 TCCCCAGAGCTGCCTCAGGCAGG - Intronic
998172001 5:139877969-139877991 TGCCCAAAGGTGCCACGGTCTGG + Intronic
998426212 5:142030813-142030835 TGCCCTGAGCTGGGGCAATCAGG - Intergenic
998923715 5:147099477-147099499 GGCCCTGAGCTGCCATCATCTGG - Intergenic
1000587095 5:163113665-163113687 TGCCCTAAACAGCCAAAGTCAGG + Intergenic
1002078722 5:176725371-176725393 AGCCATTAGCTGCCACAGTCAGG - Intergenic
1002494639 5:179603453-179603475 TGCCCTGTGCTGCTCCCGTCTGG + Intronic
1003489664 6:6610410-6610432 GGCCCTGAGCCCCCAGAGTCTGG + Intronic
1004966854 6:20861767-20861789 AGCCCTGAGCCGCCATTGTCAGG + Intronic
1006471549 6:34232143-34232165 TGCCCTGTGCTTCCTCAGGCTGG + Intergenic
1007954486 6:45903988-45904010 CGCCCTGGTTTGCCACAGTCAGG + Intronic
1011465680 6:87654318-87654340 TGGCCTGAGCAGCCAGAGTGAGG + Intronic
1013628364 6:111959912-111959934 TGCCCTGTGGAGCCTCAGTCAGG - Intergenic
1018862714 6:167722761-167722783 TGCCCTGGGGAGCCAGAGTCTGG - Intergenic
1018967791 6:168501928-168501950 TGCACAGAGCTGCCAGAGTGAGG - Intronic
1019626283 7:2017526-2017548 TGCCCTGGCCTGCGATAGTCGGG + Intronic
1024087005 7:45902082-45902104 TGTCCTTAGCTGCACCAGTCTGG - Intergenic
1024362263 7:48480471-48480493 TGCTCTGCCCTGCCACAGACCGG - Intronic
1034268268 7:149791490-149791512 TGCCCTGGCCTTCCACAGTCAGG - Intergenic
1034882167 7:154771013-154771035 TGCCATGAGCTGCCTCTGCCAGG + Intronic
1035314806 7:157991155-157991177 TGCCCTGTGCTGCATCAGGCTGG - Intronic
1036496813 8:9277380-9277402 TGCCCTGTGCAGCCACAGCCTGG + Intergenic
1037464718 8:19148975-19148997 TGCCACGAGCCACCACAGTCAGG + Intergenic
1037765424 8:21769540-21769562 GACCCTGAGCTCCCACAGTAGGG + Intronic
1042567205 8:70124130-70124152 TGCCCTGAGCTGCCTGCCTCTGG - Intronic
1043941071 8:86196677-86196699 TGCTCTGCCCTGCCATAGTCTGG + Intergenic
1044855377 8:96469976-96469998 TGCCTTGAGCTGACTCAGTGAGG + Intergenic
1046503718 8:115111339-115111361 TCCCCTCATCTGCCCCAGTCTGG + Intergenic
1047446010 8:124920358-124920380 CGGACTGAGCCGCCACAGTCCGG + Intergenic
1049220119 8:141425231-141425253 TGCCCAGGGCTGCCACAGGAGGG - Intronic
1049379433 8:142304736-142304758 TGCCATGAGATGCCACCTTCCGG + Intronic
1049604523 8:143523091-143523113 TGCCCAGAGGTGCCCCAGACTGG + Intronic
1049808947 8:144554602-144554624 GGACCTGATCTGCCACAGTGGGG + Intronic
1051118182 9:13721580-13721602 TGCACTGAGCTGTGACAGTTGGG - Intergenic
1053437995 9:38089997-38090019 GGCCCAGAGCTGCTACAGGCTGG - Intergenic
1055506923 9:76957495-76957517 TGCCCTAAGCAGCCACAGGAAGG - Intergenic
1057570580 9:96201394-96201416 TGCCCTGCGCTCCCTCAGTGGGG + Intergenic
1059394715 9:114027270-114027292 TGACCTGAGCTGCCACTCTTGGG - Intronic
1059908809 9:119019843-119019865 TGCCCAGAGCAGCCACCCTCAGG + Intergenic
1060826425 9:126690581-126690603 GGCCCTGAGCTGCCACGCCCGGG + Intronic
1060961444 9:127683565-127683587 GGCCCTGAGCTGCCCCAGCTGGG + Intronic
1061582451 9:131546128-131546150 TGAGCTGAGCTGCCAGAGGCGGG - Intergenic
1061746071 9:132741117-132741139 TGCCGTGACCTGGCACAGACTGG - Intronic
1062586941 9:137253782-137253804 TGCCCTGAGCCGCCACCTCCAGG + Intergenic
1203710447 Un_KI270742v1:92901-92923 TGCCCTGAGCTTGCACAAACTGG - Intergenic
1203540605 Un_KI270743v1:84553-84575 TGCCCTGAGCTTGCACAAACTGG + Intergenic
1186025498 X:5306370-5306392 TGCACTGCGCTGTCCCAGTCTGG - Intergenic
1186667854 X:11736795-11736817 TCCCCTGAGCAGCTACAGGCCGG + Intergenic
1186726810 X:12366637-12366659 TTTCCTGAGCTGGCATAGTCTGG - Intronic
1186793623 X:13023273-13023295 TGTCCTGAGCTGCCTGTGTCTGG - Intergenic
1186886713 X:13921529-13921551 TGCTCTGAGCTGCTACTCTCTGG - Intronic
1189430798 X:40945210-40945232 TCTCCTCAGCTGCCAAAGTCTGG + Intergenic
1190286187 X:48962748-48962770 TGACCTGAACTGCGACAGCCGGG - Exonic
1190303460 X:49069248-49069270 TGCCCTGACCACCCCCAGTCAGG + Intronic
1192223145 X:69211027-69211049 TCCCCCCAGCTGCCACAGGCTGG + Intergenic
1193037178 X:76964574-76964596 AGCCCTGAGCTGCCACTATAGGG + Intergenic
1195327909 X:103773014-103773036 TGCCCTGAGCAACAACAGCCGGG - Intergenic
1195962121 X:110397071-110397093 CTCCCAGAGCAGCCACAGTCTGG + Intronic
1196865882 X:120070483-120070505 TGCACTGGGATGCCACAGTTAGG - Intergenic
1196877214 X:120165797-120165819 TGCACTGGGATGCCACAGTTAGG + Intergenic
1201165423 Y:11204552-11204574 TGCCCTGAGCTTGCACAAACTGG - Intergenic