ID: 1157719936

View in Genome Browser
Species Human (GRCh38)
Location 18:49915942-49915964
Sequence CTGTGAGGCCCTTTTTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157719936_1157719946 29 Left 1157719936 18:49915942-49915964 CCATATGAAAAAGGGCCTCACAG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1157719946 18:49915994-49916016 CCATCCATCTTTGACTCTTTCGG 0: 1
1: 0
2: 1
3: 15
4: 178
1157719936_1157719938 -6 Left 1157719936 18:49915942-49915964 CCATATGAAAAAGGGCCTCACAG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1157719938 18:49915959-49915981 TCACAGAGTCCGAGTCCCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157719936 Original CRISPR CTGTGAGGCCCTTTTTCATA TGG (reversed) Intronic
901911760 1:12464496-12464518 CTGTAAGGCCACTTTTCAGATGG - Intronic
907850191 1:58248728-58248750 CTCTGAAGACCTTTTTAATATGG + Intronic
909053956 1:70800723-70800745 CTGTGAGTCTCATTTTCCTAAGG - Intergenic
910258667 1:85275848-85275870 ATGTGAAGCTCTTTTGCATAAGG - Intronic
911091650 1:94022154-94022176 CTCTGAGGCCCTTCTGCATCTGG + Intronic
913594695 1:120362375-120362397 ATGTAAAGCACTTTTTCATATGG + Intergenic
914092571 1:144516611-144516633 ATGTAAAGCACTTTTTCATATGG - Intergenic
914305960 1:146417264-146417286 ATGTAAAGCACTTTTTCATATGG + Intergenic
914596093 1:149155542-149155564 ATGTAAAGCACTTTTTCATATGG - Intergenic
915867383 1:159517503-159517525 CTATGAGGCCATTTTTCACAAGG - Intergenic
916661650 1:166927342-166927364 CTGTGATCCCCTTTATCAGATGG + Intronic
916848078 1:168673708-168673730 CTAATAGGCCCATTTTCATAGGG + Intergenic
917990310 1:180369216-180369238 CTGTGAGGACCTTTGTGATATGG - Intronic
918686486 1:187422158-187422180 CTGGAAGGCACTTTTTCACAGGG + Intergenic
920108547 1:203571283-203571305 ACGTGAGACCCTTTTTCAAAAGG + Intergenic
920946256 1:210531717-210531739 CTGTGAGAGGCATTTTCATATGG - Intronic
922362314 1:224834340-224834362 CTGTCAGACTCATTTTCATAAGG + Intergenic
924789981 1:247237136-247237158 CTGGGAGGCCCTTTTTGCTGGGG + Intergenic
924934237 1:248754927-248754949 CTGAGAGGCCCTTTCCCAGAAGG - Intronic
1063921831 10:10941062-10941084 CTGTGAGCCCCCTTTTCCTCTGG - Intergenic
1066700856 10:38126587-38126609 CTGTGAGGCAAGTTTTTATAAGG - Intergenic
1067394686 10:45903759-45903781 CTGTGAGGCACTCTGCCATATGG + Intergenic
1067863009 10:49872890-49872912 CTGTGAGGCACTCTGCCATATGG + Intronic
1071237677 10:83668099-83668121 CTTTGAGGTCTTTTTTTATAAGG - Intergenic
1071572645 10:86706459-86706481 CTGTGAGGCCCCTCTGCATGGGG - Intronic
1072988660 10:100167667-100167689 AAGTGAGAACCTTTTTCATAAGG - Intronic
1075395927 10:122126993-122127015 CTGTGGGGCCTCTTTTTATAAGG - Intronic
1077128028 11:952882-952904 CTGTGAGGCCCTCTGCCTTATGG + Intronic
1077678442 11:4218089-4218111 CTCTGTGGCCCCTTTTCCTATGG - Intergenic
1077682190 11:4252248-4252270 CTCTGTGGCCCCTTTTCCTATGG + Intergenic
1077687849 11:4314494-4314516 CTCTGTGGCCCCTTTTCCTATGG - Intergenic
1080614866 11:33937132-33937154 CTATGAGGCCCTTTATCACCGGG - Intergenic
1081549397 11:44097476-44097498 CTGTAAGGCCCTTTCTAAAAAGG + Intronic
1082751293 11:57021439-57021461 TTGTTAGGCATTTTTTCATATGG - Intergenic
1093203349 12:16216587-16216609 CTGTGAGGCATTATTGCATATGG + Intronic
1094344091 12:29447818-29447840 CTGAGAGGCCCTCTTTCAGGAGG + Intronic
1097751788 12:63363031-63363053 ATGTGAAGCATTTTTTCATATGG + Intergenic
1098160230 12:67642539-67642561 CTGTGAAGGCCTTTCTGATAAGG - Intergenic
1100659860 12:96685354-96685376 CTGTAAGGCCCTGTATGATATGG - Intronic
1100708614 12:97229044-97229066 CTGTGAGGCCCTTCATCACCTGG + Intergenic
1102754062 12:115322643-115322665 ATGTAAGGCCCTGTTTCACATGG + Intergenic
1103851671 12:123937420-123937442 CTGAGAGGCTCTTTTTCATGCGG + Exonic
1104535894 12:129617759-129617781 CTCTGATGCCTCTTTTCATAAGG + Intronic
1106829886 13:33568963-33568985 TTGTGAAGCCATTTTTAATAGGG - Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108900176 13:55392961-55392983 GTGTGAAGCCCTTTGTCTTAAGG - Intergenic
1111814895 13:93139903-93139925 CTGTCCGCCCCTTTTTGATAAGG - Intergenic
1115138398 14:30139663-30139685 CTGTGAGGCTGTTCTTCAAATGG + Intronic
1115336803 14:32250294-32250316 CTGGCAGGCCATTTTGCATATGG - Intergenic
1115390424 14:32848476-32848498 ATTTCAGGCCCTTTTTCACATGG - Intergenic
1116781457 14:49241692-49241714 CTGTGACTCCCTTTTTCACTGGG - Intergenic
1121136061 14:91499885-91499907 ATGTGAGGCCCTTTCTTGTAGGG + Intronic
1124022403 15:25936874-25936896 CTGTGAGGCCCCTTTTATGAGGG - Intergenic
1128688419 15:69704825-69704847 CTCTGGGGCCTTTTTTCAAAAGG + Intergenic
1128950085 15:71870285-71870307 CTGTGACACCTTTTTTCCTATGG - Intronic
1129603651 15:77014341-77014363 CTATTAGGCCCATTTTCACAGGG + Intronic
1130635831 15:85619127-85619149 CTGACAGAGCCTTTTTCATAGGG + Intronic
1130773308 15:86946962-86946984 CTGTGTGGCATCTTTTCATATGG + Intronic
1131428468 15:92366912-92366934 CTCTGAGGCACTTTTTTTTAAGG + Intergenic
1135280613 16:21151213-21151235 ATGTGAGTCCCTACTTCATAGGG + Intronic
1135759522 16:25126057-25126079 CAGTGAGGTCCTTCTTCCTAGGG + Intronic
1137902498 16:52283884-52283906 CTGTGGGGCCCTGTTTCACGTGG - Intergenic
1138572078 16:57881654-57881676 CTGTGAGATCCTATTTTATAAGG - Intergenic
1140444297 16:75012426-75012448 CTGTGCCCCCCTTTTCCATATGG + Intronic
1141173983 16:81707472-81707494 CTGTGAGGGCTTTTTCCATCCGG - Intronic
1141345750 16:83243937-83243959 CTATGAAGCCCTTTCCCATATGG + Intronic
1144326324 17:14184975-14184997 CAATGAGGCCCTCTTTCCTAAGG + Intronic
1144475200 17:15581848-15581870 CAATGAGGCCCTCTTTCCTAAGG + Intronic
1150345285 17:64399866-64399888 TTGTCAGGCCCTTCTTCATTAGG - Intronic
1150727955 17:67666783-67666805 CTGTTAGGACCTTTTTGCTATGG - Intronic
1151147828 17:72057781-72057803 CTGTGTGCCCTTATTTCATAAGG + Intergenic
1152236777 17:79143057-79143079 CTGTGAGTCCCCTTTACAGATGG - Intronic
1154383932 18:13876512-13876534 CTGTGAGGCCCAATTTCCAATGG - Intergenic
1156689940 18:39695552-39695574 CTAATATGCCCTTTTTCATAGGG - Intergenic
1157719936 18:49915942-49915964 CTGTGAGGCCCTTTTTCATATGG - Intronic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
1160106914 18:75986977-75986999 CTGTGAGTCCCCATTTCACAGGG + Intergenic
1161640726 19:5421042-5421064 TTGTGGGGCCCTTTCTCAAAGGG - Intergenic
1162462114 19:10819387-10819409 CTGTGATGCCATTTTACAGAGGG - Intronic
1163361737 19:16851165-16851187 CTGTGAGGCCTTTATGGATAAGG - Intronic
1166393830 19:42424667-42424689 CTGTGAGGCCCTGGTCCAGAGGG - Intronic
925603388 2:5631723-5631745 ATGTAAAGCACTTTTTCATATGG + Intergenic
925786033 2:7431882-7431904 CTGTGAAGTCCTCTTTCATATGG + Intergenic
925900627 2:8506863-8506885 CTGTGATGCTCATTTACATAAGG - Intergenic
928750201 2:34461545-34461567 TTGTGAGACCCTGTTTTATAGGG + Intergenic
929320341 2:40536130-40536152 ATGTAAGGCTCTTTTTCATCTGG + Intronic
931115101 2:59157427-59157449 CTCTGAGGTCCCTTATCATAGGG - Intergenic
933818184 2:86085835-86085857 CTCTGAATCCCTTTTTCCTATGG - Intronic
938543941 2:132310126-132310148 CTGTGACGGTCTTTTTAATATGG - Intergenic
938772153 2:134509960-134509982 CTGTGGGGCCCTATTTCAGCAGG + Intronic
941849916 2:170169857-170169879 CTTTGAGCCTCTTTTTCTTAAGG + Intergenic
942419320 2:175791752-175791774 CAGTGAGGCCCTGTCTCAAAAGG + Intergenic
942472308 2:176273597-176273619 CTTTGAGATCCTTATTCATAAGG + Intronic
944995821 2:205292253-205292275 CTGTGAGTCTTTTTTTTATAAGG - Intronic
947205747 2:227659527-227659549 CTGGGAGGTCCTCTTTAATAAGG - Intergenic
947247022 2:228060114-228060136 TTTTCAGACCCTTTTTCATAGGG - Intronic
948977632 2:241473207-241473229 CTGTGAGGACCCTTTTCTAAGGG + Intronic
1169231347 20:3890579-3890601 GTGTGATGCCATTTTACATATGG + Intronic
1175569103 20:60005811-60005833 CTGTGAGACCCTCTATCACATGG + Intronic
1178165322 21:29968152-29968174 CTCTGGGGCACTTTTTCATCAGG + Intergenic
1179835297 21:44027836-44027858 CTCTGGGGCCCTTTTTTATAAGG - Intronic
1180091713 21:45536893-45536915 CTGTGGGGTCCTTGTCCATAAGG - Intronic
1180185329 21:46136525-46136547 CTGTGAGGCCCCTTGTCTGAGGG - Intronic
1182541625 22:31046173-31046195 CTGAGAGGTGCTATTTCATATGG + Intergenic
1184128992 22:42506066-42506088 CAGTGAGACCCTGTTTCAAAAGG + Intergenic
1184189175 22:42883628-42883650 CTTTGAGGCCCTTTGTGATCAGG - Intronic
949187515 3:1210777-1210799 ATGTGAGCCCCTTGTTCAAAAGG + Intronic
950107943 3:10400102-10400124 AGGTGAGGCCCCTTTTCACAGGG - Intronic
951906558 3:27713144-27713166 CTGGGAGGCTCTTTTTAAAAGGG - Intergenic
954101189 3:48373945-48373967 CTGTTACTCCCTTTTTCCTAAGG + Intronic
955713531 3:61804788-61804810 CTGTGAGGCCTATTTTTAAAAGG - Intronic
962119859 3:132549976-132549998 TTGTGAGGCCCTTTGTGATCTGG + Intergenic
963745537 3:149120790-149120812 CTGTGAGGCCCTGTGTTATCTGG - Intergenic
967263024 3:187663320-187663342 CTGTCAGGCTCTTTCTCTTATGG - Intergenic
969234459 4:5855794-5855816 CTGTGAGGCCCTTGCTCATGTGG - Intronic
969655502 4:8495389-8495411 CTGTGAGGCCCTTGACCAGAGGG + Intergenic
969868691 4:10091821-10091843 CTGTGAGGCCCTTTGACACAGGG - Intronic
975283631 4:72592305-72592327 CCGTGAGGCCATTGTTGATAAGG + Intergenic
977500127 4:97827807-97827829 GTATGAGGCCATTTTTCTTAAGG - Intronic
980206710 4:129729097-129729119 CTCTGGGGCCTCTTTTCATAAGG - Intergenic
983507787 4:168573712-168573734 CTAGGAGGCCCTCTTTCCTATGG + Intronic
985048653 4:185967504-185967526 TTGTGGGGAACTTTTTCATAAGG + Intergenic
986576409 5:9217842-9217864 CTGTGAAGTTCTTTTTTATATGG + Intronic
987555623 5:19443626-19443648 CAGGGAGCCCCTTTTTCATTTGG + Intergenic
991283833 5:64946890-64946912 CTGTTTGGCTCTTTTTCATCAGG - Intronic
993331297 5:86603813-86603835 CTGTGAGGATTTTTTTCCTAAGG - Intergenic
993411577 5:87580078-87580100 CTGTGAGGCCCTTGGAGATAGGG - Intergenic
994144067 5:96372907-96372929 CTGTGAAGCTCTTTTTCATTGGG - Intergenic
995921975 5:117325329-117325351 ATATGAGGCCCTTGTTCAAAAGG + Intergenic
996228081 5:121026326-121026348 CAATGAGGCCCTTGTTCTTAGGG - Intergenic
1002445898 5:179289713-179289735 CAGTGATGCCCTTCTTCATTTGG - Intronic
1003744194 6:8981167-8981189 CTCTGAGGTCTTTTTTTATAAGG - Intergenic
1008613564 6:53205717-53205739 CTTATAGGCCCTTCTTCATAGGG - Intergenic
1011234489 6:85201173-85201195 CTGACAGGCTTTTTTTCATATGG + Intergenic
1012430047 6:99154514-99154536 CTAGGAGATCCTTTTTCATAAGG - Intergenic
1016639536 6:146333253-146333275 CTCTGAGACCCTTCCTCATATGG + Intronic
1017585096 6:155911663-155911685 CTGTGAAGCTATTTTTCAGATGG - Intergenic
1019158921 6:170056758-170056780 CTGTGTGGAACTTTATCATAAGG + Intergenic
1019330998 7:460751-460773 CTGTCAGGCCCATTTACAGAAGG + Intergenic
1021477528 7:21079699-21079721 CTGAGAGGCCCTGTGTCATTTGG - Intergenic
1021776612 7:24060321-24060343 CAGTCAGGCTCTCTTTCATAGGG - Intergenic
1021963188 7:25892843-25892865 CTTTCAGGCCTTTTTTCAAATGG - Intergenic
1022633075 7:32104163-32104185 GTGTGAGGACCCTTTTAATATGG - Intronic
1024436169 7:49357418-49357440 GTGTGAGTCCCTGTTTCAGAGGG - Intergenic
1028078226 7:86541639-86541661 CTGTGAGTTCCTTGTTGATAGGG - Intergenic
1030542662 7:110851612-110851634 ATGTGAGGCCATTTTCCAAAAGG + Intronic
1033391530 7:140933158-140933180 CTCTGGGGCCCCTTTTTATAAGG + Intergenic
1035645367 8:1214654-1214676 CTCTGAGGTCCTTTTTAACAAGG + Intergenic
1035702950 8:1651273-1651295 CTGTGTGGCCCTTCTTCACAGGG + Intronic
1037283547 8:17271242-17271264 CTGTTAGCCTCTTTTTCATTTGG + Intronic
1039167424 8:34699667-34699689 CTGTCAAGCCCTTTTATATAAGG + Intergenic
1042811321 8:72828388-72828410 CTATGAGGCCATTCATCATATGG + Intronic
1043255842 8:78135649-78135671 CTGTGGGCCTCTTTTTCAGAGGG + Intergenic
1043551323 8:81376198-81376220 CTGAGAGGCCCTATTCCAGAAGG + Intergenic
1045729014 8:105212582-105212604 CTGTGTAGCCCTTAATCATAGGG + Intronic
1045847521 8:106656391-106656413 CTCTGGGTCCCTTTTTTATAAGG + Intronic
1046831646 8:118752666-118752688 CTCTGAGGCCTCTTTTTATAAGG - Intergenic
1047281405 8:123449278-123449300 CTTTGAGTCCCTTTTTCATCAGG + Intronic
1047330385 8:123881665-123881687 CTGTGTGGCCCATCTTAATAAGG + Intronic
1048092926 8:131260719-131260741 CTTTGAGGACCATTTACATATGG - Intergenic
1048686827 8:136913298-136913320 GTGTGAGGCCAGTTTTCCTAAGG + Intergenic
1048871054 8:138799549-138799571 CTCTGAGGCCAATTTTCAGAGGG + Intronic
1050100937 9:2119070-2119092 ATGTTAGGTACTTTTTCATATGG + Intronic
1057517634 9:95735547-95735569 CTGGGAGGCCCTTCTTGATCTGG + Intergenic
1059549003 9:115208652-115208674 GTTTGAGGGCCTTTTTCAAAAGG - Intronic
1061101925 9:128498647-128498669 CTGTGTGCCCATTTTTCAGATGG - Intronic
1186052557 X:5614336-5614358 TTGGGAGGTCCTCTTTCATAAGG + Intergenic
1186548961 X:10482016-10482038 CTGTTAGGCCCATTTTCATTTGG - Intronic
1189528842 X:41857136-41857158 CTTTGAGGCCCTCTATTATAGGG + Intronic
1189759212 X:44304289-44304311 CTGTAAGGCCCTTTTACCTCTGG - Intronic
1190265449 X:48825191-48825213 CTGTGAGGCTCCTATTTATAAGG - Intergenic
1192944284 X:75949222-75949244 CAGTCAGACCCTTTTCCATAGGG + Intergenic
1194321570 X:92454022-92454044 CTGTGAGCCACTTTTTAAAATGG - Intronic
1194529320 X:95025611-95025633 AGGTGAGGACCTTTTTGATATGG + Intergenic
1196232621 X:113241234-113241256 CTGTGAAGGTGTTTTTCATATGG - Intergenic
1196512738 X:116531406-116531428 CTCTGAGGCTGTTTTTCATAAGG - Intergenic
1198251262 X:134881098-134881120 CTGGGAGGCCTTTTTTCAGAGGG + Intergenic
1200629742 Y:5567501-5567523 CTGTGAGCCACTTTTTAAAATGG - Intronic
1200902353 Y:8445496-8445518 CTGTCAGTGCCTTTTCCATAGGG - Intergenic
1201236725 Y:11919063-11919085 CTCTGAGGTCCTTTTTCTAAGGG + Intergenic