ID: 1157720797

View in Genome Browser
Species Human (GRCh38)
Location 18:49922639-49922661
Sequence TGGCAAATGCCAGGAGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157720792_1157720797 0 Left 1157720792 18:49922616-49922638 CCCTTTAGCAAAACTTGCTAAGA 0: 1
1: 0
2: 1
3: 21
4: 171
Right 1157720797 18:49922639-49922661 TGGCAAATGCCAGGAGGATAAGG 0: 1
1: 0
2: 1
3: 25
4: 238
1157720791_1157720797 11 Left 1157720791 18:49922605-49922627 CCTCTCTTTGACCCTTTAGCAAA 0: 1
1: 0
2: 0
3: 9
4: 164
Right 1157720797 18:49922639-49922661 TGGCAAATGCCAGGAGGATAAGG 0: 1
1: 0
2: 1
3: 25
4: 238
1157720793_1157720797 -1 Left 1157720793 18:49922617-49922639 CCTTTAGCAAAACTTGCTAAGAT 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1157720797 18:49922639-49922661 TGGCAAATGCCAGGAGGATAAGG 0: 1
1: 0
2: 1
3: 25
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157720797 Original CRISPR TGGCAAATGCCAGGAGGATA AGG Intronic
901333032 1:8424899-8424921 TGGGAACTGCAAGGAGGACAGGG + Intronic
902133202 1:14281622-14281644 GAGGAAATGCCAGGAAGATAAGG - Intergenic
902373524 1:16019418-16019440 TGGGAACTGCCAGTTGGATAGGG - Intronic
905587173 1:39129651-39129673 TGGCAAATGCAAGGAGGTCCTGG - Intronic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
906683982 1:47750976-47750998 AGGCAAATGGCAGGAGGGAATGG - Intergenic
906953087 1:50350159-50350181 TTGCAAATGCAACCAGGATAAGG - Intergenic
907800553 1:57760971-57760993 TGGCAAATGACATGAGTATAAGG + Intronic
908385426 1:63636590-63636612 TGGTAAGTGCCAGGAGGAGGAGG - Intronic
909246599 1:73293190-73293212 TGACAAATTCCCTGAGGATAAGG + Intergenic
910545469 1:88411314-88411336 TAGCAAATGCCATAAAGATAGGG - Intergenic
913095277 1:115510657-115510679 TTGCAAATTCCAGGAGGAAGAGG + Intergenic
913370376 1:118092481-118092503 TGGCACAAGCCAGGAGCACAGGG - Intronic
915075086 1:153301492-153301514 TGGAAAATGCCAGAAGGTGAGGG - Intronic
917780918 1:178396083-178396105 TGGCAAATACCTGGAGGAAAAGG + Intronic
920283196 1:204859422-204859444 GGGAAGATGCCAGGAGCATATGG + Intronic
920420096 1:205827383-205827405 TGTCAAAGCCCAGGAGGACATGG + Intergenic
922006233 1:221533368-221533390 AGGCAAATGCCTGGCGGATAGGG + Intergenic
922776922 1:228219106-228219128 TGGCATGTGCCAGGAGGGCAGGG - Intronic
922970475 1:229732300-229732322 TGGCAAATGTCTTGGGGATAGGG - Intergenic
923160032 1:231307590-231307612 TGGCTAAGGCCAGCAGGATAAGG - Intergenic
923456400 1:234169095-234169117 TGGCTAATGCCAGAAGAAGATGG + Intronic
923624069 1:235599900-235599922 ATGCAAATGCCAGGAGGACAAGG - Intronic
924102853 1:240622243-240622265 TGGGAAAAGCCAGGGAGATATGG - Intergenic
924634355 1:245771662-245771684 TGTCATATGCCAGGAGTAAACGG + Intronic
1063608582 10:7544030-7544052 TGGAAAATTCCAGAAGGATATGG + Intergenic
1064605422 10:17033999-17034021 TTGCAACTGAAAGGAGGATACGG + Intronic
1067179343 10:43973158-43973180 TGGCAGAGGCCAGGTGGATGGGG - Intergenic
1071406549 10:85339792-85339814 TGCCAAATGCTTTGAGGATATGG + Intergenic
1072441468 10:95459837-95459859 AGGCAACTGCCAGGAAGATAAGG + Intronic
1072703976 10:97666643-97666665 TGACAAAAGCCAAGAGGAAATGG + Intronic
1073195328 10:101686135-101686157 TAACCAATGCCAGGAGGAAAAGG - Intronic
1073882211 10:107996167-107996189 TGGTAAAGACCAGGAGGAAAAGG + Intergenic
1074865762 10:117543560-117543582 TGGCGAGTGCGAGGAGGGTAGGG - Exonic
1075919579 10:126199243-126199265 TGGACAATGACAGGAGGATGAGG + Intronic
1077384260 11:2261590-2261612 AGGCAAATGCCAGGAGGAGGGGG + Intergenic
1078187465 11:9064593-9064615 TGGCAAATGGGATGAGGAAATGG + Intronic
1079130333 11:17743585-17743607 AGTGAAATGCCAGGAGGATTGGG + Intronic
1082784665 11:57310307-57310329 TGGCATCGGCCAGGAGGAGATGG - Exonic
1082862094 11:57866667-57866689 TGGCACAAGCCAGGTGGAGAAGG + Intergenic
1083806643 11:65078393-65078415 TGGTAAATGCCAGGTTGATAGGG - Exonic
1084789265 11:71463140-71463162 TGGAACATTCCAGGAGGAGAGGG + Intronic
1086044104 11:82512466-82512488 TGACAAGTGCCAAGGGGATATGG + Intergenic
1086470418 11:87103318-87103340 TGGCAAGTACCTGGAGGAAAAGG - Intronic
1087692891 11:101342442-101342464 AAGCAAATGCCAGGAGGAACTGG + Intergenic
1088990277 11:114947829-114947851 AGGCAGATTCCAGCAGGATATGG + Intergenic
1089610822 11:119667554-119667576 TTGGAGAGGCCAGGAGGATAAGG + Intronic
1089784688 11:120899517-120899539 TGGCACATGGCAGGGGGACAGGG - Intronic
1090078789 11:123596648-123596670 TGGCAAGAGCCAGGAGGCTTTGG + Intronic
1095756346 12:45770950-45770972 AGTCAAATGCCAGGCAGATAGGG - Intronic
1096178437 12:49538279-49538301 TGACAAATGCCAGAGGGAAATGG + Intergenic
1096563084 12:52451210-52451232 AAGCAAATGCCAGGAGTATATGG - Intronic
1096565236 12:52472870-52472892 AAGCAAATGCCAGGAGTATATGG - Intronic
1096621732 12:52869629-52869651 TGTCAAATGCAAGGAGGAGCAGG + Intergenic
1097403547 12:59160256-59160278 TGTCAAAGGCCAAAAGGATATGG - Intergenic
1098108578 12:67097250-67097272 TGGCATATGCCCAGAGGAAAAGG - Intergenic
1101878120 12:108608779-108608801 TGGCAACTGCCTGGAGGAGGTGG - Intergenic
1102574331 12:113846534-113846556 TGGCAAATGCCGTGGGGAGATGG + Intronic
1102680830 12:114689274-114689296 TTGGAAATGCCAAGAGGAGAAGG - Intergenic
1103040667 12:117692870-117692892 TGGCAGTTGCCATGGGGATAGGG + Intronic
1103195005 12:119036452-119036474 TGGAAAATAGCAGCAGGATATGG - Intronic
1105208158 13:18240468-18240490 TGGCACATGTCAGGTGGAAATGG + Intergenic
1105806607 13:23955170-23955192 TGGCAAGTGAGAGGAGGAAAGGG + Intergenic
1108584584 13:51859156-51859178 TTACAAATGCCCTGAGGATAGGG - Intergenic
1109229123 13:59734696-59734718 TGACAAATGCCAGTAAGAGAAGG - Intronic
1111775259 13:92653410-92653432 TGGTGAAAGCCAGGAAGATACGG + Intronic
1111971728 13:94923833-94923855 TGGCTAATGCCAGGATGTAAAGG + Intergenic
1112579110 13:100663234-100663256 TGGCAAAGGTCTGGAGGAGAAGG + Intronic
1112973712 13:105291354-105291376 TGGCCAATGACTGCAGGATATGG - Intergenic
1113445048 13:110359478-110359500 TGGCAAATGCCAGGTTGTCAAGG + Intronic
1119328261 14:73775056-73775078 GGGCATCTGCCAGGAGGAAAAGG + Intronic
1120450337 14:84658430-84658452 AGGGAAATGCCAGAAGGACAGGG + Intergenic
1122169002 14:99855403-99855425 TGGCAAATGTCAGGAGGCCAGGG + Intronic
1202853693 14_GL000225v1_random:37148-37170 GGGCAAAAGCCAGGAGGACCGGG + Intergenic
1202854801 14_GL000225v1_random:43590-43612 GGGCAAAAGCCAGGAGGACTGGG + Intergenic
1202856248 14_GL000225v1_random:53612-53634 GGGCAAAAGCCAGGAGGACCAGG + Intergenic
1202859459 14_GL000225v1_random:72418-72440 GGGCAAAAGCCGGGAGGATCGGG - Intergenic
1124201484 15:27682047-27682069 TGGCAAAGGCCAGAAAGAAAGGG - Intergenic
1125887103 15:43237199-43237221 TGGCAAGTGCCAAGGGAATATGG - Intronic
1127213727 15:56802161-56802183 TGCCAAACCCCAGGAAGATAAGG - Intronic
1128216788 15:65939916-65939938 TTGCAAGTTCCATGAGGATAAGG + Intronic
1128493493 15:68174468-68174490 TGGCAAAAAGCAGGAGGAAAAGG - Intronic
1129442028 15:75588562-75588584 TGGCTCATGCCTGGAGGCTAAGG + Intergenic
1131078847 15:89517118-89517140 GGCTAACTGCCAGGAGGATAAGG - Intergenic
1132312064 15:100864521-100864543 TGGCAACTTCCAGGAGGACCTGG - Intergenic
1133126269 16:3648193-3648215 TGGCACATGGCAGGAGGCTGAGG + Intronic
1134383785 16:13752962-13752984 TGGCCAATCACAGGAGGAGAAGG - Intergenic
1136910634 16:34141699-34141721 TAACAAATGCCAGGAGGAAGAGG - Intergenic
1137692135 16:50436088-50436110 TGGCACACCCCAGGAGGACACGG + Intergenic
1137728158 16:50670722-50670744 TGGGAGATGCCAGGAGGAGCTGG + Intronic
1138747942 16:59385393-59385415 TGGTGAATGCCAATAGGATACGG + Intergenic
1140713296 16:77697910-77697932 TGGCAAATGCCAGGTACAGAGGG + Intergenic
1141012944 16:80420047-80420069 CTGGAAATGCCAGGAGAATAAGG + Intergenic
1141236674 16:82224701-82224723 TGTCAAATGCCAGGAGAAGATGG + Intergenic
1142485732 17:246721-246743 AGGCAAGTGCCAGGAAGAGATGG + Intronic
1147262100 17:39214637-39214659 TGGGCAATGCCAGGATGAGAGGG - Intronic
1149422010 17:56520515-56520537 TGGCAGAGGCCAGAAGGATGGGG + Intergenic
1149507350 17:57205331-57205353 TGGTAAATGGCAGGAAGAGAAGG - Intergenic
1153254415 18:3156190-3156212 GGTCAAATGCCAGGAGGAATTGG - Intronic
1155710484 18:28871124-28871146 TGGCAGTTGCAAGGAGGAAATGG + Intergenic
1157720797 18:49922639-49922661 TGGCAAATGCCAGGAGGATAAGG + Intronic
1159571846 18:70123490-70123512 AGGCAAGTGGCAGGTGGATATGG - Intronic
1159651322 18:70982454-70982476 TGGCAAAAGCCAGATGGATCAGG + Intergenic
1160243315 18:77137874-77137896 GGGGAAATGCCAGGTGGAGAGGG + Intergenic
1160631989 18:80253384-80253406 TGACACATGCCTGGAGGAGAGGG - Intergenic
1161915263 19:7223573-7223595 TGGCCAATTCTAGGAGGATCAGG + Intronic
1163849577 19:19655558-19655580 TGGCAAACACCAGGAGGAAGAGG + Exonic
1163922623 19:20306489-20306511 TGGCACATGCCTGGAGGCTGAGG + Intergenic
1163946572 19:20541560-20541582 TGGCACATGCCAGGAGGCTGAGG - Intronic
1164446090 19:28318696-28318718 TGGCACATGTAAGGAGGACACGG - Intergenic
1166701895 19:44886914-44886936 TGGCAAATGCCTGTAGGCTGAGG + Intronic
1167288623 19:48612822-48612844 TTGCAAGTCCCAGGAGGACAAGG + Intronic
925788133 2:7452892-7452914 TGGCAAATTCCAGGAGCAAGGGG + Intergenic
928108096 2:28485736-28485758 TGGTAAATTCCAGGAGGGCAAGG - Intronic
929673595 2:43901438-43901460 TGGCCAATGCCTGGATGACACGG + Exonic
930615148 2:53585785-53585807 TGTTAAATTCCATGAGGATAAGG + Intronic
930879984 2:56259578-56259600 CTGAAAATGCCAGGAGGATCAGG - Intronic
933044823 2:77522117-77522139 TGGCAAAAGCCAGCACAATAAGG - Exonic
934554718 2:95281275-95281297 TGGCGAACACCAGGAGGATGAGG - Exonic
935093468 2:99919438-99919460 TGGCAGCTGCCTGGAGGATTGGG - Intronic
935244117 2:101203476-101203498 TGAAAAATGCCAGGAGGAGTCGG - Intronic
936273702 2:111072101-111072123 TGGCAAATTCCAGGCTGAAACGG - Intronic
937434464 2:121869105-121869127 TGGCAAGTGCCAGCAGGAAAAGG - Intergenic
939257758 2:139766451-139766473 TGGCAAATATTAGGAGGTTAGGG - Intergenic
940582556 2:155600580-155600602 TGCCAAATGGCAGGAGCAAAAGG - Intergenic
944583825 2:201156314-201156336 TGGGAAATGCAAGGTGGACAAGG - Intronic
945400662 2:209378547-209378569 GGGCAGAGGCCAGAAGGATATGG - Intergenic
945896850 2:215492733-215492755 TGGCAAATTCCAGGATGTGAAGG - Intergenic
947592370 2:231393108-231393130 TGGCAGATACCAGGAGAAGAGGG - Intergenic
1170184976 20:13578962-13578984 TGGTAAATGCCATGAGGAGTGGG + Intronic
1171906091 20:30900407-30900429 TAACAAATGCCAGGAGGAAGAGG - Intergenic
1172041216 20:32047334-32047356 TGGAAAATGCCATGAGGCCAGGG + Intergenic
1172706331 20:36884834-36884856 TGGCAAACGCTAGGGGGAGAAGG - Intronic
1172912733 20:38421949-38421971 TGGAAAAGGTCAGGAGCATATGG + Intergenic
1173711679 20:45162980-45163002 TGGCAAAGGCCAGAAAGCTAAGG + Intergenic
1174584979 20:51601461-51601483 GGGCCAATGCCAGGAGGCTGTGG - Intronic
1174639123 20:52027867-52027889 TGGCATATGCCAGGAGCAAAGGG - Intergenic
1175001177 20:55632262-55632284 AGGCAGTTGCCAGGACGATAGGG + Intergenic
1175791817 20:61744743-61744765 TGGAATATGCCAGGATGAAAGGG - Intronic
1176725083 21:10424952-10424974 AGCCATATGCCAGGAGGAAAAGG + Intergenic
1180339514 22:11606526-11606548 TAACAAATGCCAGGAGGAAGAGG - Intergenic
1180758720 22:18182357-18182379 TGGCACATGTCAGGTGGAAATGG + Intergenic
1180769007 22:18366149-18366171 TGGCACATGTCAGGTGGAAATGG + Intergenic
1180777305 22:18496246-18496268 TGGCACATGTCAGGTGGAAATGG - Intergenic
1180810025 22:18753556-18753578 TGGCACATGTCAGGTGGAAATGG - Intergenic
1180826882 22:18869373-18869395 TGGCACATGTCAGGTGGAAATGG + Intergenic
1181196171 22:21187808-21187830 TGGCACATGTCAGGTGGAAATGG - Intergenic
1181213358 22:21305316-21305338 TGGCACATGTCAGGTGGAAATGG + Intergenic
1182067250 22:27439246-27439268 TGGTGAGTGACAGGAGGATATGG + Intergenic
1183498771 22:38165477-38165499 GGGCAAAGGCCAGGAGCACAAGG + Intronic
1184903030 22:47459231-47459253 TGCCAAATGCCAGGATGATCAGG + Intergenic
1203230629 22_KI270731v1_random:107033-107055 TGGCACATGTCAGGTGGAAATGG + Intergenic
1203277022 22_KI270734v1_random:95283-95305 TGGCACATGTCAGGTGGAAATGG + Intergenic
949823192 3:8137561-8137583 TGGTAAATTCCAAGGGGATATGG + Intergenic
950171229 3:10840267-10840289 GGGCAAAAGCCAGGAGGCTGGGG - Intronic
951462669 3:22968297-22968319 TGGGAAAGGAAAGGAGGATATGG + Intergenic
952828015 3:37540048-37540070 TGGTAAAAGCCAAGAGGATATGG + Intronic
954070976 3:48142611-48142633 TGGCAAATGCCAGGCAGGTGAGG + Intergenic
955511782 3:59688367-59688389 TGGTAACTGCCATGTGGATAGGG - Intergenic
955719274 3:61864508-61864530 AGGCAAATCCCAGGGGGATTAGG + Intronic
955972352 3:64447811-64447833 AGGAAAATGCCAGGAGGTTAGGG + Intergenic
956895891 3:73659432-73659454 TGGCAAATGCTAGGAGGGTATGG - Intergenic
957759753 3:84539719-84539741 TGGCCAAAGCCAGAATGATATGG + Intergenic
957959182 3:87227449-87227471 TGGCAAAGGACAGGAGGAAAAGG - Exonic
960704214 3:120466268-120466290 TGGAAAATGACAGAAGGATCTGG + Intergenic
960734781 3:120766860-120766882 TGGCAAGGGGCAGGAGGACACGG - Intronic
962735839 3:138324430-138324452 TAACTGATGCCAGGAGGATAGGG + Intronic
964700467 3:159560381-159560403 TGGCAACTGCCTGCAGGATGTGG + Intronic
964756976 3:160097284-160097306 TGGTAAAGGCCATGAGGTTAAGG - Intergenic
966200650 3:177357451-177357473 TGCCAGATGCCAGAAGGAAATGG + Intergenic
969069234 4:4520281-4520303 TCTCAAATTCCAGGAGAATATGG + Intronic
970635054 4:18000199-18000221 TGGTAAGTGCCAGAAAGATAGGG + Intronic
971235233 4:24835749-24835771 TGTCAAAAGCCAGGAAAATAAGG + Intronic
973994386 4:56442324-56442346 TGGGGAATGGCAGGAGGAGAAGG - Intronic
976776481 4:88711841-88711863 GGGCAAATACTAGGAGGAGAGGG - Intergenic
976995113 4:91421975-91421997 TGGCAAAAGCCAGCAAGAAAAGG + Intronic
978053652 4:104235954-104235976 TAGCAAAGGCCAGTATGATAAGG - Intergenic
979990758 4:127372692-127372714 TGACAAATGCCAAGATCATAAGG - Intergenic
983996157 4:174184869-174184891 AGGAAAATGCAAGCAGGATAAGG - Intergenic
984831889 4:183983612-183983634 TGGCAACTCCCAGGAGGGAAGGG - Intronic
986554425 5:8997202-8997224 TGGCACATCCAAGGAGGAAAAGG - Intergenic
986926839 5:12764969-12764991 TGGCAGATGCCTGAAGGACATGG + Intergenic
991585430 5:68196883-68196905 TGACAAATGCCACAAGGAAAAGG + Intronic
993206567 5:84889109-84889131 TATCAAATGCCAGGAGGATGTGG - Intergenic
994568543 5:101483888-101483910 TGGCAAATCCCAGGGGGGAAAGG + Intergenic
994716745 5:103330666-103330688 TGGCAAATGTCTGGGGGAAAGGG + Intergenic
994868310 5:105308695-105308717 TGGAAAGTGGCAGGGGGATAGGG + Intergenic
995458574 5:112378182-112378204 TGGGAAATACCAGGAGTATCAGG - Intronic
996954295 5:129164492-129164514 TGAGAGAGGCCAGGAGGATAGGG + Intergenic
997358613 5:133280284-133280306 TGGCAAGTGGCAGGTGGGTATGG + Intronic
997821661 5:137071389-137071411 TGACAAATACCAGGAAGATAGGG + Intronic
998529444 5:142871315-142871337 GGGCAGCTGCCAGGAGGATCAGG - Intronic
998997396 5:147880571-147880593 AGGCAAATGTCAGGATCATAAGG - Intronic
1002110068 5:176902720-176902742 TGGCGAATGCCTGGGGGAAATGG + Intergenic
1002351691 5:178588499-178588521 TGGCAAATGCCTGGAGACCAGGG - Intronic
1003037150 6:2652171-2652193 TGACAAATGCCTTGGGGATAGGG - Intergenic
1003969334 6:11283052-11283074 TGGCAAATGCCAAGGTCATAAGG - Intronic
1004376847 6:15097876-15097898 TGAAAAAAGCCAGGAGGAGAAGG - Intergenic
1006931395 6:37690884-37690906 TGGCAAAGGCCTGGAAGCTAAGG - Intronic
1008357239 6:50569083-50569105 AAGGAAATCCCAGGAGGATATGG + Intergenic
1008441679 6:51539056-51539078 TGGCATATGACAGAAGGACAAGG - Intergenic
1009235151 6:61114358-61114380 TGGCAAGCCCCAGGAGAATATGG + Intergenic
1010128665 6:72465487-72465509 TGGCCAAGGAGAGGAGGATAAGG + Intergenic
1010751930 6:79625771-79625793 TTGCAACAGCCAGGAAGATAAGG + Intergenic
1011765427 6:90614672-90614694 AGACAAATGCCAGGAGTATGAGG + Intergenic
1012095229 6:94949048-94949070 TGGCAAAGGCCACGTGGGTAAGG + Intergenic
1013237962 6:108215507-108215529 TGGGAAAAGACAGCAGGATAGGG - Intronic
1013853454 6:114542671-114542693 TCTCAAATGCGAGGAAGATATGG + Intergenic
1014817624 6:125953004-125953026 TGACAAATGGCAGGAGCAAAAGG + Intergenic
1016627634 6:146191013-146191035 TGGCAAGTGCATGGAGGATGAGG - Intronic
1017545954 6:155450776-155450798 GGGGAAAAGCCAGGGGGATATGG + Intronic
1018663349 6:166109991-166110013 TGACAAATGCTCTGAGGATAGGG + Intergenic
1018807401 6:167271903-167271925 TGGGAAATGAATGGAGGATAAGG + Intronic
1020929371 7:14373941-14373963 TGGCAGATGCCTAGGGGATAAGG - Intronic
1021715492 7:23458292-23458314 AGGGAAAAGCCAGGAGGATGTGG - Intronic
1027543735 7:79500439-79500461 TGGCAAAAGACAGGAGAATTGGG - Intergenic
1028926495 7:96362243-96362265 TGTCACGGGCCAGGAGGATAGGG - Intergenic
1029112666 7:98221785-98221807 TGGCCCATGCAAGGAGGAGAAGG - Intronic
1029201849 7:98844524-98844546 TGACATATGCCATGAGTATAAGG + Intergenic
1029238415 7:99142755-99142777 TGGGAAAGACCAGGAGGATGAGG + Intronic
1029614736 7:101649211-101649233 GGGGAAGAGCCAGGAGGATATGG + Intergenic
1031293880 7:119977114-119977136 TGGCCATTGTCAGGAGGATCCGG - Intergenic
1032127116 7:129203296-129203318 TGGCAAAGGCCTGGAGGACAGGG + Intronic
1032837867 7:135690579-135690601 TGTCAAATCCCAGAAGGAGATGG + Intronic
1034440011 7:151081563-151081585 TGGCAAAGGCCAGGAGACTGAGG + Exonic
1034612718 7:152386470-152386492 AGCCATATGCCAGGAGGAAAAGG - Intronic
1035981383 8:4375886-4375908 AGGCAAATGCCTTCAGGATACGG + Intronic
1036574653 8:10015317-10015339 TGGCAAATGGAACTAGGATATGG + Intergenic
1040728590 8:50414103-50414125 TGAGAAATCCCAGGAGGAAATGG - Intronic
1040760134 8:50831645-50831667 TGGCAAATATCAGAAGGACAGGG + Intergenic
1041691302 8:60690580-60690602 TGCTAAAGGCCAGCAGGATAAGG + Intronic
1042152532 8:65803829-65803851 TGGCAAATCCCAAGAGAATTTGG - Intronic
1042735889 8:71988030-71988052 TCGGAAAGGCCAGGAGGATGAGG - Intronic
1045060143 8:98403822-98403844 TGGTAAGTGCCAAGGGGATATGG + Intronic
1046996166 8:120526166-120526188 TTGCAAATGGTAGGAGGTTATGG - Intronic
1047228942 8:122979678-122979700 TGGTAAATGGCAGGAGGGGAAGG - Intergenic
1048474501 8:134731095-134731117 TAGCAAGTGTCAGAAGGATATGG + Intergenic
1048963412 8:139598087-139598109 AGGCAAAGTCCAGGAGGATGAGG + Intergenic
1049377132 8:142294621-142294643 TGGCCAAGGCCAAGAGGAGATGG + Intronic
1050637177 9:7624734-7624756 TGGGCAGTGCCAGGAGGAAATGG - Intergenic
1052711088 9:32056498-32056520 AGGCAAGTGCCAGGTGGAGAAGG + Intergenic
1053293765 9:36899031-36899053 TGGGAAAAGGCAGGAGGAGAGGG - Intronic
1053375545 9:37603032-37603054 TGCCAAATCCCAGGAGGGTGTGG + Intronic
1056051944 9:82777949-82777971 TGGTGAATGCCAAGGGGATATGG + Intergenic
1058241870 9:102572784-102572806 TTGCAAATGCTGTGAGGATAAGG + Intergenic
1061820923 9:133226815-133226837 TGGCCAGTGCCAGGAGGTGAAGG - Intergenic
1187461521 X:19491470-19491492 AGGCAAATGGGATGAGGATATGG + Intronic
1188107760 X:26164185-26164207 TGGGAGATTCCAGGAAGATATGG + Intergenic
1188111148 X:26197407-26197429 TGGGAGATTCCAGGAAGATATGG + Intergenic
1189010213 X:37039521-37039543 TGGTAAATGCCAAGGGGCTATGG - Intergenic
1189038370 X:37516187-37516209 TGGTAAATGCCAAGGGGCTATGG + Intronic
1190751413 X:53364969-53364991 TGGCATGTGCCAGTAGGATAAGG - Intergenic
1191730643 X:64331567-64331589 TGGTAACTGCCAGAAGGATCGGG - Exonic
1191919799 X:66243342-66243364 TGGAGGATGCCAGGAGGCTAAGG + Intronic
1191937645 X:66442240-66442262 AGGGAAATGCCAGGAGGGGAAGG + Intergenic
1193092303 X:77508167-77508189 TGACAAATGTCAGGAAGAAATGG + Exonic
1194917482 X:99723194-99723216 TGGAAAATCCCAGGAGACTAGGG + Intergenic
1194976682 X:100403293-100403315 TGGCAAATGCCTGGAGGAACTGG - Intronic
1195444197 X:104932328-104932350 TATTAAATCCCAGGAGGATAGGG + Intronic
1195991657 X:110688735-110688757 TGCCAAATGCCCGGAGGTTTGGG + Exonic
1196318102 X:114253722-114253744 TGGATAATGCCAGGAGGAAGGGG - Intergenic
1197484343 X:127029118-127029140 GGGCAAATGCCTGTAGGAGAGGG + Intergenic
1197579295 X:128262176-128262198 TGGATAATGCCAGGAGGGAATGG + Intergenic
1198302598 X:135345999-135346021 TGGTAAATGCCAGAGGGAAATGG - Intronic
1201177049 Y:11315709-11315731 AGGCATAAGCCAGGAGGACAGGG + Intergenic