ID: 1157721280

View in Genome Browser
Species Human (GRCh38)
Location 18:49926467-49926489
Sequence GGTCCCAGTGGGACAGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157721270_1157721280 28 Left 1157721270 18:49926416-49926438 CCACTTCTGGTTCCTTCCACCTT 0: 1
1: 0
2: 5
3: 46
4: 473
Right 1157721280 18:49926467-49926489 GGTCCCAGTGGGACAGGCTCTGG 0: 1
1: 0
2: 1
3: 35
4: 272
1157721273_1157721280 9 Left 1157721273 18:49926435-49926457 CCTTCTGATATGAGCGAGTTGTT 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1157721280 18:49926467-49926489 GGTCCCAGTGGGACAGGCTCTGG 0: 1
1: 0
2: 1
3: 35
4: 272
1157721269_1157721280 29 Left 1157721269 18:49926415-49926437 CCCACTTCTGGTTCCTTCCACCT 0: 1
1: 0
2: 1
3: 44
4: 456
Right 1157721280 18:49926467-49926489 GGTCCCAGTGGGACAGGCTCTGG 0: 1
1: 0
2: 1
3: 35
4: 272
1157721272_1157721280 12 Left 1157721272 18:49926432-49926454 CCACCTTCTGATATGAGCGAGTT 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1157721280 18:49926467-49926489 GGTCCCAGTGGGACAGGCTCTGG 0: 1
1: 0
2: 1
3: 35
4: 272
1157721271_1157721280 16 Left 1157721271 18:49926428-49926450 CCTTCCACCTTCTGATATGAGCG 0: 1
1: 0
2: 0
3: 34
4: 451
Right 1157721280 18:49926467-49926489 GGTCCCAGTGGGACAGGCTCTGG 0: 1
1: 0
2: 1
3: 35
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157721280 Original CRISPR GGTCCCAGTGGGACAGGCTC TGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900598842 1:3494483-3494505 GCGCCCAGGGGGACAGGCTGGGG + Exonic
901749196 1:11395690-11395712 TCTTCCAGTGGGACAGGCTGCGG - Intergenic
902292451 1:15444423-15444445 GGTCCCAGAGGGTCAGGAGCAGG - Intronic
902434784 1:16391518-16391540 GGTCCTAGCAGGTCAGGCTCTGG + Intronic
902746371 1:18477226-18477248 GCCACCAGTGGGACAGGCTGAGG + Intergenic
902746621 1:18478832-18478854 GCTACCAGTGGGACAGGCTGAGG + Intergenic
904350869 1:29905396-29905418 GCTTCCAGTGGGCCATGCTCAGG - Intergenic
906275662 1:44513309-44513331 GGCCCCCATGGGCCAGGCTCGGG - Intronic
906282810 1:44565776-44565798 GGTGCCAATGGGACTGGATCTGG + Intronic
907509258 1:54946205-54946227 GGACCCACTGGGGCAGGCACGGG - Intergenic
908097775 1:60758416-60758438 CATTCCAGTGGGACAGGCTGTGG - Intergenic
917114008 1:171583417-171583439 CCTCCCAGTGGGACAGGATGTGG - Intronic
919172184 1:193968796-193968818 GGGCACAGAGGGACAGGCACAGG + Intergenic
920178136 1:204116137-204116159 GGATCCAGTGGGACACACTCAGG - Intronic
922042559 1:221910978-221911000 GGTCCCTGTGGGACTGCCACTGG + Intergenic
922960857 1:229644595-229644617 GGTGCCAGGGGGGCAGGCCCTGG + Intronic
924416503 1:243861453-243861475 ATTCCCAGTGAGACAGACTCTGG - Intergenic
924496420 1:244594767-244594789 GATCCCAGTGGGAAAAGTTCTGG - Intronic
1063450335 10:6146083-6146105 GGTCGCAGTGGGGGAGTCTCGGG - Intronic
1064318339 10:14278366-14278388 GTTCCCAGAGGCTCAGGCTCCGG + Intronic
1064996811 10:21303308-21303330 TGCCCCAGTGGGTCAGCCTCAGG + Intergenic
1066040446 10:31544030-31544052 GCTCCCAGTGTGACAGACTAAGG + Intergenic
1068958575 10:62844105-62844127 ATTCCCTGTTGGACAGGCTCTGG + Intronic
1069625652 10:69866305-69866327 GCTCCCACTGTGGCAGGCTCTGG - Intronic
1070695837 10:78562383-78562405 GGTCCCAGTGAGAAACTCTCAGG - Intergenic
1070774168 10:79100193-79100215 AGCCCCAGGGGGACAGGTTCAGG + Intronic
1071530316 10:86386020-86386042 CGTCACAGTGGGGCAGTCTCAGG - Intergenic
1071789901 10:88942489-88942511 GGTTGCAGTGGGAGAGGCCCTGG + Intronic
1073704022 10:105961687-105961709 GCTCCCAGTGAGACTGGCTGAGG - Intergenic
1073745867 10:106467554-106467576 GGACCCAGTGAGCCAGGCACGGG - Intergenic
1074977626 10:118594437-118594459 GGTCCCAGTCGGCCTGGCTCTGG + Exonic
1076218929 10:128717668-128717690 GGTCCCAGAGGCCCAGGCTCAGG + Intergenic
1076510053 10:131006965-131006987 GGTGCCAGTGGGATACCCTCAGG + Intergenic
1077231386 11:1459532-1459554 GGTCCCACTGGTGCAGGCTGTGG + Intronic
1077283809 11:1757089-1757111 TCTCCCAGTGGGAGGGGCTCGGG - Intronic
1077303424 11:1857315-1857337 GGTCCAGCTGGGACAGGCCCTGG + Intronic
1077474171 11:2778589-2778611 GGTGCCTGGGGGAGAGGCTCCGG - Intronic
1079081370 11:17415592-17415614 GGTGCCATTGGTGCAGGCTCTGG + Intronic
1079333565 11:19552438-19552460 GGGCCCAGCAGGACAGGCCCTGG - Intronic
1080457161 11:32428148-32428170 GGCCCCAGTGCCCCAGGCTCAGG - Intronic
1081673013 11:44951924-44951946 GGTCACAGTGGGCCAGGAACCGG + Intergenic
1081931546 11:46875012-46875034 GATGCCAGTGGGGCAGGCACAGG + Exonic
1081957862 11:47109191-47109213 AGGCTCAGTGGGAGAGGCTCAGG - Intronic
1083547037 11:63556568-63556590 GGGCACGGTGGGACATGCTCTGG - Intronic
1083882783 11:65556849-65556871 AGGCCCCGTGGGCCAGGCTCGGG - Intronic
1084456390 11:69270293-69270315 GGTCCCTGTGGGACTCCCTCCGG - Intergenic
1084664518 11:70569286-70569308 GGTCCTGGGGGGTCAGGCTCGGG + Intronic
1088118682 11:106341725-106341747 GCTTCCAGTGGGACAAGATCTGG + Intergenic
1090540082 11:127692241-127692263 TGTTCCAGTGGGACAGGATGTGG - Intergenic
1091364164 11:135003758-135003780 TGTTCCAGTGGGACAGGGTGTGG - Intergenic
1091460584 12:641375-641397 GGTTCCAGTTGGAGAGTCTCTGG + Intronic
1091781247 12:3215821-3215843 GGTCCCGGTGGAACGTGCTCTGG - Intronic
1091781259 12:3215887-3215909 GGTCCCGGTGGAACGTGCTCTGG - Intronic
1092287454 12:7136972-7136994 GGCCCCAGTGGGCTGGGCTCTGG + Exonic
1092291717 12:7163304-7163326 GGTCGCAGTGTGGCTGGCTCTGG + Intergenic
1093015527 12:14150940-14150962 GGACCCAGTGTCACAGGCCCTGG + Intergenic
1096453933 12:51769930-51769952 GGTCCCTGTGGAACAGCCTGAGG + Exonic
1101537716 12:105634587-105634609 TTTCCCAGGGGAACAGGCTCAGG + Intergenic
1101791533 12:107932077-107932099 GTTCCCACTGGGACCTGCTCAGG + Intergenic
1101970288 12:109308041-109308063 GGTCCCACTGGGCCAGGTTGTGG + Intronic
1102028791 12:109728238-109728260 GGACCCAGTGGGACAGTCCCTGG - Intronic
1104745514 12:131207939-131207961 GATCTCAGTGGGGCTGGCTCAGG - Intergenic
1104788826 12:131469170-131469192 GATCTCAGTGGGGCTGGCTCAGG + Intergenic
1107259118 13:38470211-38470233 GGACCCCGTGTGACAGGCTGAGG - Intergenic
1108681844 13:52787387-52787409 GGCCCCAGTGCCAGAGGCTCTGG + Intergenic
1113104645 13:106759187-106759209 AGGCCCTGTGGGACAGGCTGAGG + Intergenic
1113154276 13:107300076-107300098 GGTCCCACTGGGACAGTATGTGG + Intronic
1113909147 13:113833924-113833946 GGCACCAGTGTGACAGGCCCCGG + Intronic
1113909189 13:113834140-113834162 GGCACCAGTGTGACAGGCCCCGG + Intronic
1113993570 14:16048957-16048979 GTTCCCAGTGGGAGAGTGTCAGG + Intergenic
1114614560 14:24061448-24061470 GGCCCAAGGGGGACAGGATCAGG - Intronic
1114631935 14:24164742-24164764 GGCTCCAGTGGGCCAGGCTTGGG - Exonic
1116152097 14:41154372-41154394 CCTCCCCGCGGGACAGGCTCGGG - Intergenic
1117842091 14:59870556-59870578 GGTCCCAGTGGCTCAGGCACCGG - Exonic
1118574796 14:67231546-67231568 GGACCCAGTGGCTCAGGCTGAGG - Intergenic
1119615497 14:76096212-76096234 GGAACCTGTGGGAGAGGCTCTGG - Intergenic
1121689936 14:95870627-95870649 TTTCCCAGTGGGAGAGGCTAGGG + Intergenic
1122286902 14:100657740-100657762 GGTTCCAGTGGGAGGAGCTCAGG + Intergenic
1122401450 14:101469772-101469794 GTTCCCATGGAGACAGGCTCAGG + Intergenic
1122793077 14:104192616-104192638 GGGGTCAGTGGGACAGGCTCTGG + Intergenic
1122841606 14:104467212-104467234 GGTCCCTTTGGGAAAGGCTGGGG + Intergenic
1123450987 15:20358569-20358591 GGACCCAGTGTGACAGAATCCGG - Intergenic
1123468064 15:20530666-20530688 GGTACCTGTGGCTCAGGCTCAGG + Intergenic
1123650049 15:22470376-22470398 GGTACCTGTGGCTCAGGCTCAGG - Intergenic
1123728379 15:23125875-23125897 GGTACCTGTGGCTCAGGCTCAGG + Intergenic
1123740455 15:23279218-23279240 GGTACCTGTGGCTCAGGCTCAGG - Intergenic
1123746543 15:23323340-23323362 GGTACCTGTGGCTCAGGCTCAGG + Intergenic
1123766998 15:23490974-23490996 GGACACAGTGGTCCAGGCTCTGG + Intergenic
1124278810 15:28346657-28346679 GGTACCTGTGGCTCAGGCTCAGG + Intergenic
1124303889 15:28564951-28564973 GGTACCTGTGGCTCAGGCTCAGG - Intergenic
1124724679 15:32145715-32145737 GGTCCCACTGGGCCAGGCACAGG + Intronic
1125715869 15:41819620-41819642 TCTCCCAGTGGGACAGGCTTCGG - Exonic
1127658817 15:61080978-61081000 GGACCCAGAGGGAGAGGCACCGG - Intronic
1129382666 15:75177971-75177993 GGCCCCAGTGAGCCAGGCCCTGG + Intergenic
1129661193 15:77554022-77554044 GGCCCCAGGAGGACAGGCCCAGG - Intergenic
1132352557 15:101148951-101148973 GACCCCAGTGGGAAAGGTTCTGG + Intergenic
1132469363 16:93358-93380 GCTCCCGGTGGGCCAGCCTCAGG - Intronic
1132576544 16:666943-666965 GGGTCCCGGGGGACAGGCTCAGG - Exonic
1133255176 16:4512212-4512234 GGTCCCAGGGGGAAAGAGTCTGG + Exonic
1136116712 16:28099195-28099217 GCGCCCAGTGGGACAGGCCTTGG - Intronic
1136275998 16:29179848-29179870 GGGCCCAGTGGTCCAGCCTCTGG + Intergenic
1136695061 16:32071920-32071942 GGACCCAGTGGGAGAGGCTTGGG - Intergenic
1136795561 16:33015179-33015201 GGACCCAGTGGGAGAGGCTTGGG - Intergenic
1136874361 16:33839197-33839219 GGACCCAGTGGGAGAGGCTTGGG + Intergenic
1137725605 16:50654776-50654798 GATCCTAGTTTGACAGGCTCAGG + Intergenic
1139473536 16:67190979-67191001 GATCCTAGTGGGATAGGCTGAGG + Intergenic
1139513633 16:67440998-67441020 GGCCCCACTGGGGCAGGCTGTGG - Intronic
1140869077 16:79090208-79090230 GGTCTGAGTGGGCCAGGGTCGGG + Intronic
1203097815 16_KI270728v1_random:1276843-1276865 GGACCCAGTGGGAGAGGCTTGGG - Intergenic
1142959620 17:3544509-3544531 GGTGCCAGAGAGACAGGATCCGG - Intronic
1143110652 17:4550958-4550980 GCTCCCAGTGGGATAGTGTCCGG + Intronic
1143140203 17:4738314-4738336 GGCCCCAGGGGAAAAGGCTCAGG + Intronic
1143300752 17:5909055-5909077 GGCCCAAGTGGCACAGGCTATGG + Intronic
1143499204 17:7329221-7329243 GGCCCCAGCGGGAGCGGCTCAGG - Exonic
1143824062 17:9590008-9590030 GCTCCCAGCTGAACAGGCTCAGG - Intronic
1143889039 17:10088310-10088332 GGTACCACTGGGACAGGCCATGG + Intronic
1144726094 17:17503554-17503576 GGCCGCGGTGGGACAGGCTCTGG + Intergenic
1145251469 17:21299024-21299046 GGTCAGAGAGGGTCAGGCTCTGG + Intronic
1147450680 17:40502032-40502054 GGTCACACTGGGACAGGCACAGG + Intergenic
1147968695 17:44207893-44207915 GGTCCTGGGGAGACAGGCTCTGG + Exonic
1148376989 17:47157009-47157031 GTTCCCAGTGGGACAGTATCAGG + Exonic
1151315301 17:73318207-73318229 GGTCACAGTGGGTGAAGCTCTGG - Intergenic
1152037120 17:77880363-77880385 GGTCCCAGCAGGGCAGGTTCAGG + Intergenic
1152337457 17:79706776-79706798 GGACCCAGTGTGACAGAATCCGG + Intergenic
1152377834 17:79927892-79927914 GGTCCCTGCGGGGCTGGCTCTGG - Intergenic
1152417054 17:80169507-80169529 GGTCCCGGTGGGCCATGATCAGG + Intergenic
1154135550 18:11774703-11774725 GTACACAGGGGGACAGGCTCTGG - Intronic
1155052609 18:22161959-22161981 GGTCCAAGAGGGCCAGGCCCAGG - Intergenic
1155218248 18:23662336-23662358 GGACCCAGAGGGTCAGGGTCGGG + Intronic
1156459453 18:37313592-37313614 GGCTGCGGTGGGACAGGCTCTGG - Intronic
1156898341 18:42272236-42272258 GTTCCCAGTGGGAAATGCTGAGG + Intergenic
1157290588 18:46406771-46406793 GGTCCCTGTGGGACAGGATGAGG - Intronic
1157721280 18:49926467-49926489 GGTCCCAGTGGGACAGGCTCTGG + Intronic
1157761303 18:50267499-50267521 GGTCACAGTGGACCAGGGTCAGG + Intronic
1157813140 18:50711926-50711948 TGTCCGAATGGGAGAGGCTCTGG - Intronic
1158382748 18:56952185-56952207 TGTCCCTGTGGGACTGCCTCTGG + Intronic
1160838010 19:1133484-1133506 GGCCCCAGTGGGGCTGGCACAGG - Intronic
1161021899 19:2014806-2014828 GGTCCCAGGGGTACAGGGCCTGG + Intronic
1161041529 19:2113153-2113175 GGTCCCAGTGGGCCAAGCAGGGG - Intronic
1161194978 19:2981617-2981639 GGCCCCACTGGGACAAGCTGAGG + Intronic
1161304262 19:3557938-3557960 GGAGCGAGTGGGACGGGCTCTGG + Intronic
1162376727 19:10309518-10309540 GGGCCCAGCGGGACAGGGCCGGG - Exonic
1162542988 19:11309353-11309375 GGGCCCAGTGGGCCAGTGTCTGG - Intronic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1165078467 19:33293968-33293990 GGTCCCTGTGTGACATGCCCTGG + Intergenic
1165138594 19:33686062-33686084 GGTCCCAGAGGGAAAAGCTGGGG + Intronic
1165266436 19:34666162-34666184 GGACCCTGTGGGACAGGGACAGG - Intronic
1166283571 19:41810389-41810411 GGTCCCAGCTGTGCAGGCTCTGG + Intronic
1166410760 19:42554305-42554327 GGTCCCAGCAGTACAGGTTCAGG - Intronic
1166739589 19:45105793-45105815 AGTCCCAGGGGGTCAGGCCCGGG + Intronic
1167571670 19:50292588-50292610 GGTCCCAGGGTGTAAGGCTCGGG + Intronic
1168280866 19:55304774-55304796 GGTCCCGGTGGGACTGGCCCGGG - Exonic
1168688443 19:58362563-58362585 GGTCCCAGAGGGCCCAGCTCAGG + Intronic
1168714016 19:58516756-58516778 GGTCTCAGTGGGACAGCCTTCGG + Exonic
926613326 2:14969820-14969842 GGTCCCAGTGATAAAGGCTTCGG + Intergenic
927248499 2:20977684-20977706 GGCAGCAGTGGGACAAGCTCTGG + Intergenic
927248606 2:20978429-20978451 CTTCCCAGGGGGACAGGATCTGG - Intergenic
927991936 2:27454068-27454090 GGTGCTTGTGGGACAGGCCCGGG - Exonic
929592331 2:43155402-43155424 GGGCCCTGTGAGGCAGGCTCAGG - Intergenic
929816559 2:45237519-45237541 GGACCCAGTGGCACAGCCACGGG + Intergenic
929978612 2:46658089-46658111 GCACCAAGTGGGACAGGGTCGGG + Intergenic
930641016 2:53854486-53854508 GGTCACAGAAGGACAGGTTCAGG + Exonic
935790172 2:106583816-106583838 AGTCCCAGGGCGTCAGGCTCCGG + Intergenic
935802648 2:106714261-106714283 GGTCCCACTGGCACATGCTGAGG + Intergenic
936147138 2:109987478-109987500 GGTCTCGGTGGGACAGCCTTCGG + Intergenic
936197554 2:110384005-110384027 GGTCTCGGTGGGACAGCCTTCGG - Intergenic
937853974 2:126659552-126659574 GCTCCCAGTGGCAGAGGCTTGGG + Intronic
938538109 2:132261911-132261933 GTTCCCAGTGGGAGAGTATCAGG - Intergenic
939997077 2:148930061-148930083 GGTACCTGTGGTACTGGCTCTGG + Intronic
944645171 2:201772816-201772838 GCTTCCAGTGGGACAGTCTATGG + Intronic
946161035 2:217836197-217836219 CCTCCCAGGGGTACAGGCTCGGG - Exonic
948284778 2:236775074-236775096 GGTGCGAGTGGGGCAGGGTCTGG + Intergenic
948284945 2:236776762-236776784 GGTTCCAGTGGGGCAGACACAGG - Intergenic
948994683 2:241572442-241572464 GGGCCCAGAGGGCCAGGCTGCGG - Exonic
1169012904 20:2265298-2265320 GATACCAGGGGAACAGGCTCTGG + Intergenic
1169214942 20:3787731-3787753 TGACCCAGGGGGACAGGCTGAGG + Intronic
1171136335 20:22698082-22698104 GGTGGCAGTGGAACAGGCTCAGG - Intergenic
1171811460 20:29746902-29746924 GTTCCCAGTGGGACAGTATCAGG - Intergenic
1171867015 20:30493696-30493718 GTTCCCAGTGGGACAGTATCAGG - Intergenic
1172125418 20:32622633-32622655 TGTCACAGGGGGACAGGGTCAGG + Intergenic
1172167643 20:32908658-32908680 GCTCCCAGAGGGAGAGGCTGAGG - Intronic
1173386623 20:42594272-42594294 GGTCGTGGTGGGACAGGATCTGG - Intronic
1174307798 20:49626860-49626882 GGTGGCATGGGGACAGGCTCAGG - Intergenic
1175245424 20:57579274-57579296 GGTCCCAGTTGGACTGTGTCTGG - Intergenic
1175245443 20:57579358-57579380 GGTCCCAGTTGGACTGTGTCTGG - Intergenic
1175245462 20:57579442-57579464 GGTCCCAGTTGGACTGTGTCTGG - Intergenic
1175871577 20:62211800-62211822 GGTGCCCCTGGGACAGGTTCTGG - Intergenic
1175904368 20:62372307-62372329 GGCCCCAGGGGTAGAGGCTCAGG - Intergenic
1176412007 21:6454188-6454210 GATCCCAGGGGGAGAGGCTGGGG - Intergenic
1176553529 21:8242281-8242303 GTTCCCAGTGGGACAGTATCAGG + Intergenic
1176572451 21:8425305-8425327 GTTCCCAGTGGGACAGTATCAGG + Intergenic
1176580360 21:8469865-8469887 GTTCCCAGTGGGACAGTATCAGG + Intergenic
1178040354 21:28633948-28633970 GGGCCCAATGGAACAGGCTTCGG + Intergenic
1179687501 21:43062510-43062532 GATCCCAGGGGGAGAGGCTGGGG - Intronic
1180085406 21:45505827-45505849 GGTCCCAGCAGGTGAGGCTCTGG + Exonic
1180189046 21:46154016-46154038 GGGTCCAGTGGGGCTGGCTCTGG - Intronic
1180313698 22:11258556-11258578 GTTCCCAGTGGGAGAGTGTCAGG - Intergenic
1180341642 22:11624999-11625021 GTTCCCAGTGGGAGAGTATCAGG + Intergenic
1180921020 22:19521736-19521758 GGTCCCTGTTGTACAGGCCCAGG + Intergenic
1180957929 22:19749548-19749570 GTTCCCCCTGGGTCAGGCTCAGG - Intergenic
1181014012 22:20057997-20058019 GGACCAGGTGGGGCAGGCTCAGG - Intronic
1181166642 22:20987500-20987522 GGTCCCAGTGGTAAAGGCCCTGG - Exonic
1181422294 22:22810490-22810512 GGGCCCAGTGGGAGAGGATGGGG + Intronic
1181563266 22:23717745-23717767 GGTCCCAGAGGCCCAGGGTCAGG - Intergenic
1181677436 22:24465093-24465115 GCTTCCAGTGGGACAGGATGTGG - Intergenic
1181924220 22:26345207-26345229 GGTCCCTGGGGTACAGGCCCTGG + Intronic
1184368703 22:44068981-44069003 GGTCACAGAGGGTCAGGCTGTGG - Intronic
1184616286 22:45640558-45640580 GGTCCCAGAGGGAAGGGCTGTGG + Intergenic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1185233868 22:49699945-49699967 GGAGCCAGGGGGACAGACTCAGG + Intergenic
1203258527 22_KI270733v1_random:159309-159331 GTTCCCAGTGGGACAGTATCAGG + Intergenic
949382266 3:3459658-3459680 GCTCCCAGTTGGGCAGCCTCAGG - Intergenic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
951050751 3:18090106-18090128 GCTCCCTGTGGGATAGGCTGAGG + Intronic
952446253 3:33383985-33384007 GTTCACAGTGGGACAGGCTCTGG - Exonic
953496133 3:43388397-43388419 GCTCCCAGGGTGACAGGCTGTGG + Intronic
953665783 3:44925535-44925557 TGTCCCAGTGCCACAGGCTTAGG + Exonic
953929232 3:46997698-46997720 GGGCCCGGTGGGACAGGCATGGG + Intronic
954100313 3:48367411-48367433 GTTCCCAGTAGCACAGGCACTGG + Intergenic
954519812 3:51214857-51214879 GGTCCCAGTAGGTCAGTATCAGG + Intronic
955029719 3:55204575-55204597 GATCCCAGGGGTTCAGGCTCTGG + Intergenic
958622264 3:96576394-96576416 GGGCCCAGTGGGGTAGGCACCGG + Intergenic
966914184 3:184575824-184575846 GCTCCCAGGGGGACAGGCTGTGG - Exonic
967232229 3:187350667-187350689 GGTGGCAGTGGGAGAGGCTGTGG + Intergenic
968084056 3:195866817-195866839 CCTCCCAGTGTGGCAGGCTCTGG + Intronic
968629400 4:1642363-1642385 GGTCCCTGAGTGCCAGGCTCCGG + Intronic
969356893 4:6633259-6633281 GGGCCCAGTGTGAGAGGCTTTGG - Intergenic
974894843 4:67926714-67926736 GCTCCCAGGGTGGCAGGCTCTGG - Intronic
975992039 4:80267273-80267295 GGTCCCAGTGGCCTGGGCTCAGG - Intronic
976506480 4:85853269-85853291 GGTCCCACTGAGCCAGGCACAGG + Intronic
977886463 4:102257603-102257625 GGTCCATGTGGGTCAGTCTCTGG + Intronic
978845865 4:113271935-113271957 GCTCCCAGATGGTCAGGCTCTGG - Intronic
982274587 4:153626397-153626419 GGTTCATGTGGGAGAGGCTCAGG + Intronic
985138063 4:186809230-186809252 CCTCCCAGTGGGACAAGATCTGG - Intergenic
986034479 5:3924862-3924884 GGACCCACGTGGACAGGCTCAGG + Intergenic
987744299 5:21949579-21949601 GCTTCCAGTGGGACAAGATCTGG + Intronic
991764504 5:69959715-69959737 GCTTCCAGTGGGACAAGATCTGG + Intergenic
991782820 5:70158432-70158454 GCTTCCAGTGGGACAAGATCTGG - Intergenic
991843736 5:70834787-70834809 GCTTCCAGTGGGACAAGATCTGG + Intergenic
991875262 5:71158759-71158781 GCTTCCAGTGGGACAAGATCTGG - Intergenic
992088191 5:73296857-73296879 GGTCCGAGTCAGACAGGCTCGGG + Intergenic
993894243 5:93512161-93512183 GCTCCCAGTGGGACAAGATGTGG + Intergenic
998095504 5:139393824-139393846 GATCCCACGGGGACAGGTTCTGG + Exonic
998488761 5:142527440-142527462 GGGCAGAGTGTGACAGGCTCAGG + Intergenic
999210288 5:149882268-149882290 GAGACCACTGGGACAGGCTCCGG - Intronic
999285823 5:150393662-150393684 GGTCTCACTTGGAGAGGCTCTGG - Intronic
999325921 5:150643460-150643482 GATCCCCTTGGGACAGGGTCAGG - Intronic
1001000714 5:168004371-168004393 AATCCCAGTGGAACAGGGTCTGG + Intronic
1001258743 5:170206860-170206882 TGTCGCAGTGGGAGAGGCCCAGG + Intergenic
1003116295 6:3285907-3285929 GGTCCTCCTGGGACAGGCTCAGG - Intronic
1005595779 6:27377727-27377749 TGTGCCAGTGGCACAGTCTCAGG - Intronic
1006422957 6:33947030-33947052 GGCCCCACTGGGAACGGCTCTGG - Intergenic
1007164993 6:39822888-39822910 GGGCCCAGTGTGAAGGGCTCTGG - Intronic
1007417566 6:41700920-41700942 GGTCCCAGTGGGACAGGACAGGG - Intronic
1007467993 6:42068662-42068684 GGTCCCAGGGTGACAGACTGAGG - Intronic
1008815792 6:55564081-55564103 AGTCACAGTGTGACTGGCTCTGG + Intronic
1014121715 6:117733776-117733798 GGGCCCAGTGGGAGATGCTTGGG - Intergenic
1017044938 6:150338181-150338203 GGTCCCATTGGGGCAGGATGAGG + Intergenic
1017664034 6:156701851-156701873 GGTCCCAGTAGTACTGGCTTTGG - Intergenic
1019478272 7:1254550-1254572 GGTCCCAGAGGACCAGGCTCTGG - Intergenic
1019527678 7:1488006-1488028 ACTCCCAGTGGGCCACGCTCAGG + Intronic
1019640194 7:2099231-2099253 GGTCCAGGTGAGACAGGCTGTGG - Intronic
1021097085 7:16547225-16547247 GCTCCCAGGGTGGCAGGCTCTGG - Intronic
1022302373 7:29113484-29113506 GGCACCATTGGGACAGGCACAGG + Intronic
1022315340 7:29240212-29240234 GGTCCTTGGGGGCCAGGCTCAGG - Intronic
1022505036 7:30904377-30904399 GGGGCCAGAGAGACAGGCTCAGG + Intergenic
1023843533 7:44109210-44109232 GGTCCCTGTGGGGCAGCATCTGG + Intronic
1024184404 7:46934991-46935013 CCTCCCAGTGGGACAAGCTGTGG + Intergenic
1026402438 7:70028343-70028365 AGTCCCAGTGGGACAGAACCTGG + Intronic
1026574454 7:71560569-71560591 GGTCCTAGTGGCGCAGGCACAGG + Intronic
1026841307 7:73671253-73671275 AGTCCAAGGGGGGCAGGCTCCGG - Exonic
1032026099 7:128443918-128443940 GGTCACAGTGGCCCAGCCTCCGG + Intergenic
1034343396 7:150371790-150371812 GGTCCCACTGGGCAAAGCTCCGG - Exonic
1034934501 7:155190104-155190126 AGCCCCCGTGGGACAGGCCCTGG + Intergenic
1035188397 7:157143748-157143770 AGTTCCTGTGGGACAGGCACAGG + Intronic
1035327201 7:158072915-158072937 GGGCCCCTTGGGACAAGCTCAGG - Intronic
1035613953 8:988759-988781 GGTCCCCGGGGGACAGGCCCTGG - Intergenic
1035914778 8:3607241-3607263 CTTCCCAGTGGGACAAGCTGTGG - Intronic
1039471274 8:37815088-37815110 GGTCCCAGTGGGTCTAACTCCGG - Intronic
1040111472 8:43568813-43568835 GTTCCCAGAGGGACAGGGACAGG - Intergenic
1042349292 8:67761138-67761160 GGTCCTGGTGGGATAGGCACTGG - Intergenic
1046116344 8:109788783-109788805 GCTTCCAGTGGGACAGGATGTGG + Intergenic
1049002370 8:139834151-139834173 GCTCCCACTGTGACAGGCTCTGG - Intronic
1049367710 8:142248751-142248773 AGCCCCCGTGGGCCAGGCTCAGG - Intronic
1049564785 8:143332360-143332382 GGCCTCAGTGGGAGAGGCTTTGG + Intronic
1049807358 8:144547047-144547069 GGACCCCGTGGGCCAGGCACAGG - Intronic
1051090206 9:13398234-13398256 TATCCCATTGGGACAGCCTCAGG - Intergenic
1055966034 9:81866180-81866202 GGTCCTTGTGAGACAGGCTTTGG + Intergenic
1056395174 9:86175301-86175323 GGTCCCCTTGGGAAAGCCTCGGG + Intergenic
1058876335 9:109248222-109248244 GTACCCAGTGGGAGATGCTCAGG - Intronic
1059148587 9:111926048-111926070 TGTCCTAGTGGAAAAGGCTCAGG - Intronic
1059907189 9:119000823-119000845 TGTCTCAATGGGACAGGCTAGGG - Intergenic
1061083477 9:128385961-128385983 AGTCCCAGAGGGACAAGCTGGGG - Intronic
1061871269 9:133522055-133522077 GGGCCTAGTGGCAGAGGCTCTGG - Intronic
1061932788 9:133841910-133841932 GGTCCCACTGCGGCTGGCTCTGG - Intronic
1061954272 9:133953493-133953515 GGCCCCAGTGTGCCAGGCCCAGG - Intronic
1062052643 9:134455569-134455591 GGTCAGAGAGGGACAGGCTGTGG + Intergenic
1062273656 9:135720887-135720909 GGTCCCCATGTGACAGACTCAGG + Intronic
1062343353 9:136103596-136103618 GGTGCCTGTGGAACTGGCTCAGG + Intergenic
1062397497 9:136358346-136358368 CGACCCAGGGCGACAGGCTCAGG + Exonic
1203770615 EBV:48221-48243 GGGCCCAGCGGGAGAAGCTCGGG - Intergenic
1203474722 Un_GL000220v1:141325-141347 GTTCCCAGTGGGACAGTATCAGG + Intergenic
1203362088 Un_KI270442v1:224768-224790 GTTCCCAGTGGGACAGTATCAGG - Intergenic
1185734504 X:2486687-2486709 GGACACAGTGGGGCAGGCTTTGG - Exonic
1185852215 X:3499789-3499811 GATCCCCGTGACACAGGCTCAGG + Intergenic
1191880644 X:65841226-65841248 GGGTCCAGTGGGAGAGGCCCTGG + Intergenic
1198060936 X:133044606-133044628 CCTCCCCGTGGGGCAGGCTCAGG + Intronic
1201076230 Y:10191554-10191576 ATTCCCAGTGGGACAGTATCAGG + Intergenic