ID: 1157728689

View in Genome Browser
Species Human (GRCh38)
Location 18:49985389-49985411
Sequence GGCCTCTGGTAACAGCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157728679_1157728689 24 Left 1157728679 18:49985342-49985364 CCCTTACATGTTTGCTGTCATCC 0: 1
1: 0
2: 1
3: 18
4: 191
Right 1157728689 18:49985389-49985411 GGCCTCTGGTAACAGCCTAGGGG 0: 1
1: 0
2: 0
3: 13
4: 114
1157728683_1157728689 1 Left 1157728683 18:49985365-49985387 CCCAGCTTAATTCTTCTTCAGTC 0: 1
1: 0
2: 0
3: 22
4: 276
Right 1157728689 18:49985389-49985411 GGCCTCTGGTAACAGCCTAGGGG 0: 1
1: 0
2: 0
3: 13
4: 114
1157728681_1157728689 3 Left 1157728681 18:49985363-49985385 CCCCCAGCTTAATTCTTCTTCAG 0: 1
1: 0
2: 9
3: 64
4: 494
Right 1157728689 18:49985389-49985411 GGCCTCTGGTAACAGCCTAGGGG 0: 1
1: 0
2: 0
3: 13
4: 114
1157728682_1157728689 2 Left 1157728682 18:49985364-49985386 CCCCAGCTTAATTCTTCTTCAGT 0: 1
1: 0
2: 1
3: 20
4: 271
Right 1157728689 18:49985389-49985411 GGCCTCTGGTAACAGCCTAGGGG 0: 1
1: 0
2: 0
3: 13
4: 114
1157728680_1157728689 23 Left 1157728680 18:49985343-49985365 CCTTACATGTTTGCTGTCATCCC 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1157728689 18:49985389-49985411 GGCCTCTGGTAACAGCCTAGGGG 0: 1
1: 0
2: 0
3: 13
4: 114
1157728684_1157728689 0 Left 1157728684 18:49985366-49985388 CCAGCTTAATTCTTCTTCAGTCA 0: 1
1: 0
2: 3
3: 19
4: 328
Right 1157728689 18:49985389-49985411 GGCCTCTGGTAACAGCCTAGGGG 0: 1
1: 0
2: 0
3: 13
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157728689 Original CRISPR GGCCTCTGGTAACAGCCTAG GGG Intronic
900948754 1:5845802-5845824 TGCCTCTGGGAAGAGCCCAGGGG + Intergenic
902394600 1:16125776-16125798 GGGCACTGGGAACAGACTAGGGG - Intronic
902515460 1:16987321-16987343 GGCCTCTGCTATCAGACTAGGGG - Intronic
902676972 1:18015531-18015553 GGCCTCTGGTGACAGGACAGTGG + Intergenic
912953626 1:114137352-114137374 GGACTCTGGAAACTGCCCAGTGG - Intronic
914424796 1:147565900-147565922 GGCCTCTGGTAAGAGGATGGGGG - Intronic
915117608 1:153610499-153610521 GGCCTCTGGCAGCAGCCAAGTGG + Intronic
920854222 1:209650453-209650475 GGCCTCTGTCAGCAGCCCAGAGG + Intronic
920972910 1:210757867-210757889 GGCCTCTGGCCACTGCCTAAGGG - Intronic
921066168 1:211623518-211623540 AGCCCCTGCTCACAGCCTAGTGG + Intergenic
921700040 1:218258763-218258785 GGCCACTGATATCAGCCTGGTGG - Intergenic
922861880 1:228826003-228826025 GGCCTCTGTTGACACCCAAGAGG + Intergenic
1064079581 10:12297524-12297546 GGCCTTTGATAAAAGCCAAGAGG - Intergenic
1065371757 10:24994089-24994111 GTCCTCTGAAAACAGCCTTGAGG + Intronic
1069879768 10:71584650-71584672 GGCCTCTGGCCATGGCCTAGTGG + Intronic
1071107143 10:82111486-82111508 AGCCTCAGATAACAGCATAGAGG - Intronic
1074150446 10:110755066-110755088 GGCCTCTGGTCACATCTCAGGGG + Intronic
1074974988 10:118572777-118572799 GGCCTCTGTTGACACTCTAGAGG - Intergenic
1076242405 10:128918646-128918668 GGCCTCGAGAAACAGCATAGTGG + Intergenic
1081057227 11:38424905-38424927 GGCCTCTGGTCACAGACTGAAGG + Intergenic
1084790374 11:71471879-71471901 TGCATCTCGTAACAGCCTATTGG + Intronic
1086432646 11:86750144-86750166 GGCCTCTGGGAACTGCATCGTGG + Intergenic
1091333699 11:134751110-134751132 GGCTTCTGCTGACAGCCTAGTGG - Intergenic
1095963304 12:47849399-47849421 GGCCTCTGGACACAGCCATGGGG + Intronic
1100106686 12:91183741-91183763 TCCACCTGGTAACAGCCTAGGGG - Intergenic
1100723934 12:97388349-97388371 GGCCACTGGTAAAATCCTAGTGG + Intergenic
1101226287 12:102691254-102691276 GTCCTCTGACACCAGCCTAGGGG + Intergenic
1103949989 12:124545310-124545332 GGCCTCTGGCCCCAGCCTGGTGG - Intronic
1104163611 12:126204878-126204900 GCCCTCAGTTAACAGCCAAGAGG - Intergenic
1104678587 12:130732579-130732601 AGCCTCTTGTAACAGCCAGGTGG - Intergenic
1118739892 14:68731611-68731633 GGCCTCTGGTTGCATCCTGGGGG - Intergenic
1121714140 14:96060700-96060722 GGCCTCTGGCCAAAGCATAGAGG - Intronic
1127708893 15:61575608-61575630 GGCATCTGGTCACTGCCTACAGG - Intergenic
1128861977 15:71081817-71081839 GGCATCTGGTTAGAGGCTAGTGG + Intergenic
1128867629 15:71126374-71126396 GGCCTCTAGTAACACCCGAGGGG - Intronic
1129753559 15:78082558-78082580 AGCCTCTGGGAAAACCCTAGGGG + Intronic
1130547442 15:84867493-84867515 GCCATGTGGTAACATCCTAGGGG + Intronic
1132798062 16:1735094-1735116 GGCCTCTTGTCAAAGCCAAGAGG + Intronic
1133693303 16:8236713-8236735 GGCCTGTGGTAAAGGACTAGGGG - Intergenic
1134421146 16:14091147-14091169 GGACTCGTGTAACAGCCTAATGG - Intronic
1139711359 16:68778990-68779012 GGCCTTTGGGAACAGCCAGGTGG + Intronic
1140525623 16:75620414-75620436 GGCCTCTGGGAATCCCCTAGAGG - Intronic
1141095346 16:81159160-81159182 GGCCTCCCTTAACAACCTAGAGG + Intergenic
1143205323 17:5136748-5136770 GGCCTCTGAGAAGAGCCGAGGGG - Intronic
1144560837 17:16319449-16319471 AGCCTCTGTAAAGAGCCTAGGGG + Intronic
1144876369 17:18399441-18399463 GGCCTCTGAGAAGAGCCAAGGGG - Intergenic
1145155858 17:20544979-20545001 GGCCTCTGAGAAGAGCCAAGGGG + Intergenic
1145977484 17:28992746-28992768 GGCCCCTGGTCACAGCCTCATGG - Intronic
1146835713 17:36108887-36108909 GGTCTCTGGTCTCAGCCTCGAGG - Intergenic
1146843310 17:36169044-36169066 GGCCTCTGGGAAGAGCTGAGGGG + Intronic
1146855618 17:36256985-36257007 GGCCTCTGGGAAGAGCTGAGGGG + Intronic
1146865003 17:36331390-36331412 GGCCTCTGGGAAGAGCTGAGGGG - Intronic
1146871524 17:36380896-36380918 GGCCTCTGGGAAGAGCTGAGGGG + Intronic
1146878883 17:36431978-36432000 GGCCTCTGGGAAGAGCTGAGGGG + Intronic
1146882823 17:36453124-36453146 GGCCTCTGGGAAGAGCTGAGGGG + Intergenic
1147067862 17:37931984-37932006 GGCCTCTGGGAAGAGCTGAGGGG - Intronic
1147074410 17:37981520-37981542 GGCCTCTGGGAAGAGCTGAGGGG + Intronic
1147079393 17:38011539-38011561 GGCCTCTGGGAAGAGCTGAGGGG - Intronic
1147085933 17:38061059-38061081 GGCCTCTGGGAAGAGCTGAGGGG + Intronic
1147095333 17:38135481-38135503 GGCCTCTGGGAAGAGCTGAGGGG - Intergenic
1147101878 17:38185024-38185046 GGCCTCTGGGAAGAGCTGAGGGG + Intergenic
1147894005 17:43738544-43738566 CACCTCTGGTACCAGCCAAGGGG + Intergenic
1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG + Exonic
1149846472 17:60011534-60011556 GGCCTCTGGGAAGAGCTGAGGGG + Intergenic
1150084820 17:62268109-62268131 GGCCTCTGGGAAGAGCTGAGGGG + Intergenic
1152513374 17:80805355-80805377 GGCGTCTGGAGACAGCCTGGAGG + Intronic
1156235695 18:35201960-35201982 GGCCTCCGGAAAAAGCCCAGTGG + Intergenic
1157728689 18:49985389-49985411 GGCCTCTGGTAACAGCCTAGGGG + Intronic
1159721852 18:71900057-71900079 GGCTTTTGGTATCAGTCTAGAGG + Intergenic
1161568498 19:5016870-5016892 TGCCTCTGGTGGCAGCCCAGGGG + Intronic
1163126422 19:15246656-15246678 GGCCTCTGCTCACAGCCTGCAGG - Intronic
1163481065 19:17556377-17556399 GGCCTCTGGCAACGCCCCAGTGG - Intronic
1165108456 19:33487799-33487821 GGCCTCTGCCAAGAGCCCAGAGG - Intronic
1166300329 19:41909045-41909067 GGGCTCTGGTAAGAGCCTGGAGG - Intronic
1166818932 19:45564442-45564464 GGACTCTGAGAACAGCCCAGGGG + Intronic
1168179926 19:54655006-54655028 GGTCTCTGGAAACAGCCAGGTGG - Intronic
1168179933 19:54655038-54655060 GGTCTCTGGAAACAGCCAGGTGG - Intronic
925032130 2:659186-659208 GACCTCTGGTGAAAGCCTGGAGG - Intergenic
925120613 2:1415376-1415398 GGCCTCTGGACACAGTCTCGGGG + Intronic
925201724 2:1972614-1972636 GGAGTCTGCCAACAGCCTAGGGG - Intronic
925735179 2:6957717-6957739 GGCCTCTGCTGAGATCCTAGAGG + Intronic
935899633 2:107777321-107777343 GGCATTTTATAACAGCCTAGAGG + Intergenic
938264072 2:129913754-129913776 GGCCTCTGGAGGCAGCCCAGGGG + Intergenic
939144008 2:138390701-138390723 GGAGTCTGGAAACAGCCTGGAGG - Intergenic
939617174 2:144374895-144374917 GTCCTCTGGAAACAGGCTGGCGG - Intergenic
941717243 2:168777066-168777088 GGCCTCTGGTTACAACCCAGGGG - Intergenic
941831252 2:169962442-169962464 GGCATCTGGGAGCAGCTTAGTGG - Intronic
942459407 2:176159197-176159219 GGCCTCTGGCAAGAGGCTAGGGG + Intronic
947967345 2:234292238-234292260 GGCCTCTGGAATGAGCCTGGTGG + Intergenic
1172549287 20:35786416-35786438 AGCCACTGCTCACAGCCTAGGGG - Intronic
1178974378 21:37208929-37208951 GGGCTCTGGAAACACCCTAGCGG - Intergenic
1181273300 22:21673365-21673387 GGCCTCAGGGAGCAGCCTGGTGG + Intronic
1183320803 22:37164042-37164064 GACCTCTGGAAACAGCCCAGAGG + Intronic
950332544 3:12168054-12168076 GGCTTCTTCTAACAGCCTATGGG + Intronic
951081625 3:18456545-18456567 TGCCTCTGGTCACAGCTTATTGG - Intergenic
952289419 3:32000952-32000974 AACCTGTGGTAACAGCCTTGGGG + Intronic
953396209 3:42572572-42572594 GGCCTCTGTTAACACCCTGGGGG - Intronic
955568531 3:60276730-60276752 GGCCTCTGGTGAGGGCCTTGGGG + Intronic
957129528 3:76205468-76205490 GGCATGTGGTGGCAGCCTAGAGG - Intronic
961389472 3:126543810-126543832 GGCCTCTGGACACAGCCCTGGGG - Intronic
961467390 3:127090088-127090110 GGCCTCTGGTAACACCATAAAGG - Intergenic
966321615 3:178707155-178707177 GGCCTCTGGTATAAACCTTGAGG + Intronic
968472787 4:789724-789746 CTCCTCTGGGAACTGCCTAGGGG + Intronic
970213114 4:13731415-13731437 GGCCTTTGGTCACAGACTGGAGG + Intergenic
971478694 4:27095407-27095429 GGCTGCTGGGAACAGCCCAGGGG - Intergenic
973827272 4:54720963-54720985 GACCTGTGGGAACAGCCTAATGG - Intronic
976784086 4:88798081-88798103 GGCATCTGCTCACAGCCAAGTGG - Intronic
980972591 4:139580976-139580998 CCCCTCTTGTAACAGCCCAGGGG + Intronic
985956230 5:3268176-3268198 GGCAACTGGGGACAGCCTAGTGG + Intergenic
986989347 5:13533746-13533768 GTCCTCATTTAACAGCCTAGTGG + Intergenic
999576120 5:152979143-152979165 GGCCTTTGGTTACAGACTAAAGG + Intergenic
1003604526 6:7547147-7547169 GGCCACTGGGACCAGCCCAGCGG - Intronic
1005270406 6:24157547-24157569 GGCTTCTGGTAAAATACTAGTGG - Intergenic
1005526933 6:26659996-26660018 GTCCTCGGTTAACAGCCTTGGGG - Intergenic
1005902640 6:30231045-30231067 GGCCTTTGGGAAAAGCTTAGAGG - Intergenic
1009722502 6:67490613-67490635 AGCCACTGGTACCATCCTAGTGG - Intergenic
1013316373 6:108947102-108947124 GGCCTCTGACAACAGTCTACAGG + Intronic
1020079785 7:5281340-5281362 GGCCTCAGGTAGGAGCCTGGTGG + Intronic
1026300267 7:69091548-69091570 GTCCTGTGGTCACAGCCAAGTGG - Intergenic
1038680720 8:29664527-29664549 TGCCTAGGGAAACAGCCTAGAGG + Intergenic
1053043221 9:34892151-34892173 GGCCTCTGTCCACTGCCTAGAGG - Intergenic
1057127763 9:92632704-92632726 GGCCTCTGCTAACATCCCTGTGG + Intronic
1057283514 9:93729301-93729323 GGCCTCTGGCTAGACCCTAGAGG - Intergenic
1058418639 9:104814412-104814434 GACCTCAGGTAACTGCCTTGAGG - Exonic
1059722686 9:116976626-116976648 GGCCTCTGGTAACAGAACAGAGG + Intronic
1061421026 9:130472887-130472909 GGCCTCTGCAAGCAGCCTATGGG + Intronic
1199608712 X:149596008-149596030 GGCCTCTGGTTACAACCCACAGG + Intergenic
1199630410 X:149773352-149773374 GGCCTCTGGTTACAACCCACAGG - Intergenic