ID: 1157730636

View in Genome Browser
Species Human (GRCh38)
Location 18:50001243-50001265
Sequence AGAAGGCTTTACCTCCATGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157730631_1157730636 1 Left 1157730631 18:50001219-50001241 CCAGCCAGGAAGGCCAGGACACC 0: 1
1: 0
2: 3
3: 49
4: 579
Right 1157730636 18:50001243-50001265 AGAAGGCTTTACCTCCATGATGG 0: 1
1: 0
2: 1
3: 10
4: 171
1157730632_1157730636 -3 Left 1157730632 18:50001223-50001245 CCAGGAAGGCCAGGACACCTAGA 0: 1
1: 0
2: 1
3: 26
4: 217
Right 1157730636 18:50001243-50001265 AGAAGGCTTTACCTCCATGATGG 0: 1
1: 0
2: 1
3: 10
4: 171
1157730627_1157730636 16 Left 1157730627 18:50001204-50001226 CCAGTGGGAGGAGCTCCAGCCAG 0: 1
1: 0
2: 1
3: 39
4: 317
Right 1157730636 18:50001243-50001265 AGAAGGCTTTACCTCCATGATGG 0: 1
1: 0
2: 1
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157730636 Original CRISPR AGAAGGCTTTACCTCCATGA TGG Exonic
902790834 1:18766724-18766746 AGAAGGGTTTAACCCCATGCTGG - Intergenic
908153643 1:61329889-61329911 AGGAGGCTTTCCCACCATGCTGG + Intronic
912477634 1:109950294-109950316 AGAATGATATAGCTCCATGAGGG - Intergenic
914915472 1:151816569-151816591 ACAAGGCTTAACCTGCAAGACGG - Intronic
917534450 1:175864272-175864294 ATAAGGCTTCCCCTCCAGGAGGG + Intergenic
917681194 1:177369687-177369709 AGTAGGCTTCATCTCCAGGATGG - Intergenic
921339120 1:214116829-214116851 AGAAGGCTCTATTTTCATGAGGG + Intergenic
922715372 1:227867846-227867868 ATAGGGCTTTACCTCCAAGATGG - Intergenic
923934496 1:238746266-238746288 AGATGGCTAGACCTCCGTGAAGG - Intergenic
924287834 1:242506623-242506645 ATAAAGCTTTGCCTCCATAAAGG + Intronic
1063961497 10:11309767-11309789 AGTAGGCAGTAGCTCCATGATGG - Intronic
1064327852 10:14367241-14367263 CTAAGGCTTCTCCTCCATGAGGG - Intronic
1067058745 10:43066955-43066977 CCAAAGCTTTACCTCCCTGAGGG + Intergenic
1069043972 10:63723191-63723213 AGAAGGCTATACATTCATTATGG - Intergenic
1069646675 10:70004669-70004691 AGAAGGCTTTGCCTAAATGAAGG - Intergenic
1071920422 10:90343459-90343481 AGAAGGCTTCAGTTCCTTGATGG + Intergenic
1072638475 10:97193104-97193126 AGAAGGGTTTGGCTCTATGATGG - Intronic
1073664211 10:105511449-105511471 AGAAGACTAAAGCTCCATGATGG + Intergenic
1075264584 10:120989742-120989764 TGATGGCTAGACCTCCATGAAGG - Intergenic
1075866983 10:125731604-125731626 AGAAGGCTTTGCATCTAGGAGGG + Intronic
1080030358 11:27654254-27654276 AAAAGGATTTGCCTCCGTGATGG - Intergenic
1081384200 11:42452107-42452129 TGGAGGGTTTACTTCCATGAAGG + Intergenic
1082071718 11:47944634-47944656 AAAATGTTTTTCCTCCATGAGGG - Intergenic
1083169871 11:60917044-60917066 AGAAGGCTTTCCCAGCCTGAGGG + Intronic
1083467188 11:62856265-62856287 AGGAGGCTGTAGCTCCATGGAGG - Exonic
1083519282 11:63292748-63292770 TGAAGGCATTATCTCCATGCTGG - Intronic
1085175236 11:74480623-74480645 GGATGGCTTTAGCTGCATGACGG + Intergenic
1085551707 11:77379594-77379616 ACCAGGCTATACCTCCAGGATGG + Intronic
1088741196 11:112768659-112768681 AGAAGGCCTTAACTTTATGAAGG - Intergenic
1090307020 11:125699908-125699930 AGAGGGCTTAACGTCCAGGAAGG + Intergenic
1091433872 12:459112-459134 ATAATGCTTTACCTGCCTGAAGG + Intergenic
1091976289 12:4828355-4828377 AGAATGCTGCATCTCCATGACGG - Intronic
1092446998 12:8567249-8567271 AGATGGCTAGACCTCCATGAAGG + Intergenic
1097057261 12:56257688-56257710 AGTAGGCTTTCACTCCAGGATGG + Intronic
1098313981 12:69174795-69174817 AGAAGGCATTAACTAGATGAAGG + Intergenic
1099371898 12:81843930-81843952 AGCATGCTTTCTCTCCATGAAGG + Intergenic
1101528598 12:105554570-105554592 AGAAGCCCTTTCCTGCATGAGGG + Intergenic
1104276110 12:127329259-127329281 AGATGGCTTTACCAACAAGAAGG - Intergenic
1105397820 13:20056736-20056758 AGAAGGCTTTGGCAACATGAAGG + Intronic
1109206440 13:59487878-59487900 AGCTGGACTTACCTCCATGAAGG + Intergenic
1112955566 13:105053824-105053846 ATATGCCCTTACCTCCATGAAGG + Intergenic
1113370723 13:109722690-109722712 ACAAGACATTACCTACATGAAGG + Intergenic
1114047060 14:18884459-18884481 AGATGGCGTTTTCTCCATGATGG + Intergenic
1114117154 14:19634950-19634972 AGATGGCGTTTTCTCCATGATGG - Intergenic
1114621767 14:24100259-24100281 AGAAAGCTTTTCCACCATTAAGG - Intronic
1117688760 14:58283270-58283292 ATACTGCTTTAACTCCATGAAGG + Intronic
1119339515 14:73864864-73864886 AGAAGGCTTTGCCTCACTTAAGG + Intronic
1119660528 14:76448151-76448173 AGTAGGCATTTCCTCCAGGAAGG + Intronic
1121028947 14:90641334-90641356 GGAAGGTTTCACCTCCATCAAGG + Intronic
1124663298 15:31568665-31568687 ACTAGGCCTTACCTCCAAGATGG - Intronic
1124751220 15:32372752-32372774 CATAGGCTTTAGCTCCATGAAGG + Intergenic
1129377503 15:75143344-75143366 CGATGGCTAGACCTCCATGAAGG + Intergenic
1130087170 15:80787377-80787399 AGATGGGTTTCCCTCCAGGATGG + Intronic
1130738833 15:86576870-86576892 AGGAGGCTTTACAACCATGGTGG - Intronic
1130913921 15:88290334-88290356 AGAAGGGTATTCCTCCATGGTGG - Intergenic
1131353215 15:91720538-91720560 ACAAAGATTTACCACCATGAAGG + Intergenic
1131860148 15:96645018-96645040 TGAAGGCTTTCCCTCCAAAATGG - Intergenic
1132952385 16:2570530-2570552 AGACGGATTTTCCTGCATGATGG + Intronic
1132961966 16:2629640-2629662 AGACGGATTTTCCTGCATGATGG - Intergenic
1133054304 16:3137924-3137946 AGGAGGTTTTAGCTCCATGCAGG + Intronic
1134037544 16:11042353-11042375 AGAGGGCGTTACCTCCAGGCAGG - Exonic
1134274778 16:12766416-12766438 AGAAGGCGTTTCTTACATGATGG + Intronic
1135631694 16:24040543-24040565 ACAAGGCATTAGCTCCATGAGGG + Intronic
1137354936 16:47752587-47752609 AGAAGGATCTACTTCCAAGATGG + Intergenic
1140021711 16:71245398-71245420 AGAAGTCAATACCTCAATGAAGG + Intergenic
1140686534 16:77438949-77438971 AAATGGATTTACCTCCTTGAAGG + Intergenic
1141097657 16:81174479-81174501 AGAGGCCTGTGCCTCCATGAGGG + Intergenic
1141560451 16:84864262-84864284 AGAAGGCTTTACCCGCAGGATGG - Intronic
1142583726 17:957725-957747 AGGAGGTTTGACCTCCTTGACGG - Intronic
1146536404 17:33656637-33656659 AGAGGTCTTTTCCTCCAGGAAGG + Intronic
1146811711 17:35909160-35909182 AGAAGGCTCAACCTCCATAGAGG + Intergenic
1146811844 17:35910148-35910170 AGAAGGCTCTGCCTCCATAGGGG + Intergenic
1146812256 17:35913395-35913417 AGAAGGCTCAACCTCCATAGAGG + Intergenic
1147432155 17:40378601-40378623 AGATGACTTTACATCCCTGAGGG - Intergenic
1147623274 17:41882498-41882520 AGAACCCTTTACCACCTTGAAGG - Intronic
1148851448 17:50557476-50557498 AGAAGGAGTTACCTCCTTAAAGG + Intergenic
1151094843 17:71485144-71485166 TGAAAGCTTTGCCTCCATAAGGG + Intergenic
1152462229 17:80447440-80447462 AAAAGGCTTTCCCTCCATGAAGG + Intergenic
1153069169 18:1085691-1085713 AGAAGGCTTTTATTACATGAAGG + Intergenic
1153747642 18:8196406-8196428 AGCAGTGTTTACCTCCTTGAAGG + Intronic
1153814670 18:8782244-8782266 TGAAGCCTTTTCCTCCACGAGGG + Intronic
1156147260 18:34199217-34199239 AGATGGCTTCAGCTCTATGAAGG + Intronic
1156208106 18:34907723-34907745 ACAAGGCTTCATCTTCATGATGG + Intergenic
1157730636 18:50001243-50001265 AGAAGGCTTTACCTCCATGATGG + Exonic
1159979715 18:74763489-74763511 AGAAATCTTTACCTAGATGAAGG + Intronic
1162961066 19:14127188-14127210 ACAAAGCTCTACCTCCATTAGGG + Intronic
1164781417 19:30896625-30896647 ACCAGGGGTTACCTCCATGAAGG + Intergenic
1165862993 19:38918795-38918817 ACAGGGCTTCACCCCCATGACGG - Exonic
1166357165 19:42233995-42234017 GCAAGGCTTTGCCACCATGAAGG - Intronic
1166924363 19:46256459-46256481 AGAAAGAGATACCTCCATGAGGG + Intergenic
1167816720 19:51888657-51888679 ACAAGCCTTTACATCCAGGAAGG + Intronic
925801591 2:7607440-7607462 AGAAGGCTCTACCTGCATTTTGG - Intergenic
926050368 2:9740492-9740514 AGAAGGTTTTAGCTCCCTGATGG + Intergenic
927374764 2:22401050-22401072 AGAAGGCTTAGCCCTCATGATGG - Intergenic
928158523 2:28899075-28899097 AGGAGTCTTTTCCACCATGAAGG - Intronic
938237207 2:129715977-129715999 AGAAGGCTTAAGGTCCATGCAGG + Intergenic
941048703 2:160706140-160706162 AGAAGGCTTTACCTCATCCATGG + Intergenic
944255565 2:197620162-197620184 ACAATTCTTTACCTCAATGATGG + Intronic
944560891 2:200936384-200936406 AGAAGGATTTTCCTCAATTACGG + Intronic
945986496 2:216358682-216358704 AGAAGTCTCTACCTCAATAAAGG - Intronic
947828985 2:233125587-233125609 AGGAGGCTCTCCCTCCAGGAGGG + Intronic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1171239504 20:23553609-23553631 AGCAGTCTGTACCTCCCTGAGGG + Intergenic
1172312564 20:33929844-33929866 AGTAGGCTTTCCCTGCATGCAGG - Intergenic
1172847830 20:37940389-37940411 TGAAGGCTTTCCCTCCACGTAGG + Intronic
1173619015 20:44422512-44422534 TAAATGCATTACCTCCATGAAGG + Intronic
1173764828 20:45597869-45597891 TGAAGGCTATCCTTCCATGAAGG + Intergenic
1173892624 20:46524932-46524954 GTAATGCTTTACCTCCTTGAGGG - Intergenic
1174323299 20:49759355-49759377 AGAAGGCTTTAACTACCTGAAGG - Intergenic
1180465594 22:15607110-15607132 AGATGGCGTTTTCTCCATGATGG + Intergenic
1182124529 22:27806863-27806885 AGCAGACTATAGCTCCATGAGGG - Intergenic
951391053 3:22104174-22104196 AGTTGCCATTACCTCCATGATGG + Intronic
951775676 3:26307941-26307963 AGGAGCCTTTATTTCCATGACGG + Intergenic
952270336 3:31824853-31824875 AGAAGGCTTAAGATCTATGATGG - Intronic
953182977 3:40613721-40613743 AGAAGGCCTTATCTCCAAGGAGG + Intergenic
956571649 3:70703380-70703402 AGAAAGCTTCACCTACATCAAGG + Intergenic
957599962 3:82321203-82321225 TGAGGGATTCACCTCCATGATGG + Intergenic
958652256 3:96952370-96952392 TGAAGGCTTTACCCTCATGAAGG + Intronic
961782253 3:129327113-129327135 AGAAAGCTCTGCCTCCAGGAGGG + Intergenic
962053886 3:131848217-131848239 GGAAGGCTTTGCCTCCAGGAAGG - Intronic
963107917 3:141662014-141662036 AGAATGCTTTTCACCCATGATGG + Intergenic
964363651 3:155925798-155925820 AGAAGTCTTTAACTGCAGGAAGG + Intronic
964639513 3:158893790-158893812 AGAATGCTTTACCATCATCATGG - Intergenic
967144118 3:186591604-186591626 AGAATGCTTTCCTTCCTTGATGG - Intronic
969091514 4:4697293-4697315 TGAAAGCTCTACCTCCCTGAAGG + Intergenic
970551621 4:17187296-17187318 AGAAGGATTTACCTCCAGCTAGG - Intergenic
970655566 4:18226770-18226792 GGAATGTTTTACCTTCATGAAGG - Intergenic
972668151 4:41188181-41188203 AGCAGGCTTTGCCATCATGAAGG + Intronic
972956154 4:44394931-44394953 TCAAGGCTTTTCCTTCATGATGG + Intronic
973640907 4:52901595-52901617 GGAAGGATTCACCTCCAAGATGG - Intronic
975008660 4:69321981-69322003 TGATGGCTAGACCTCCATGAAGG - Intronic
976922483 4:90456572-90456594 CGATGGCTAGACCTCCATGAAGG + Intronic
977024546 4:91799545-91799567 AGAAGGATCTATTTCCATGAAGG + Intergenic
977414018 4:96706701-96706723 AGAAAGCTTTACCTACACCAGGG + Intergenic
978695810 4:111576812-111576834 ATTAAGCTTTACCTCCATGTGGG + Intergenic
979566314 4:122157703-122157725 GGAAGGGTTTAATTCCATGATGG + Intronic
981469950 4:145121974-145121996 AAAAGGCTTTACCCACAAGATGG + Intronic
981979457 4:150773588-150773610 GGAAGGATTTTCCTCCATCAAGG - Intronic
985830464 5:2224287-2224309 AGAAGCCTTTTCCTCCAGGCAGG - Intergenic
987591054 5:19926904-19926926 ATAAGGGTATACCTCAATGAAGG + Intronic
989319865 5:40121717-40121739 TGATGGCTAGACCTCCATGAAGG - Intergenic
989854169 5:46258689-46258711 AGAAGAATTTACCTCTGTGAGGG + Intergenic
989857842 5:46320724-46320746 AGAAAGGTTTACCTCTGTGAGGG + Intergenic
990394119 5:55357522-55357544 AGATGCCTTTATGTCCATGATGG - Intronic
1000967752 5:167679886-167679908 AAAAAGCATTACCACCATGATGG - Intronic
1001994883 5:176149093-176149115 TTAAAGCTTTACCTCCTTGAGGG - Intergenic
1003012792 6:2441628-2441650 AAAAGGCTTTAACTCCACAAGGG - Intergenic
1003932889 6:10943673-10943695 ATAAGTCATTACCTCTATGAGGG - Intronic
1006588551 6:35136106-35136128 AGAAGGTTTTACCTCCAAGCAGG - Exonic
1007287119 6:40755593-40755615 AGATGGCTTGAACTGCATGAAGG - Intergenic
1020182875 7:5935826-5935848 AGAAGCCTTCGCATCCATGAGGG - Intronic
1020300037 7:6788931-6788953 AGAAGCCTTCGCATCCATGAGGG + Intronic
1022200049 7:28107968-28107990 AGAAGGCATTTGCTCCATCACGG + Intronic
1024781028 7:52848223-52848245 ATAATGCTTCACCTCCTTGAAGG + Intergenic
1025588388 7:62822695-62822717 AGAAAGCTTTATCTCTGTGAGGG - Intergenic
1025598396 7:62961850-62961872 AGAAAGCTTTAACTCTGTGATGG - Intergenic
1026077235 7:67183299-67183321 ACAAGGTTTTAACTCCACGATGG - Intronic
1026699634 7:72628802-72628824 ACAAGGTTTTAACTCCACGATGG + Intronic
1027462719 7:78475432-78475454 AGAAATATTTTCCTCCATGAAGG + Intronic
1031220745 7:118962147-118962169 AGAAGTCTTTTCCTCTTTGAAGG - Intergenic
1032196943 7:129794951-129794973 AAAATGCTAGACCTCCATGAGGG + Intergenic
1033920303 7:146383025-146383047 AGAAGGCTTTACAGCTATAATGG - Intronic
1039141292 8:34391642-34391664 AGAAGAATTTACTTCCAAGATGG + Intergenic
1041089460 8:54288503-54288525 ATCAGGCTTTCCCTCCCTGAGGG - Intergenic
1041538921 8:58961160-58961182 AGAAGGTTATACCAACATGAGGG + Intronic
1041888573 8:62842749-62842771 AGAATGTTTTTCCTCCATTATGG - Intronic
1044717142 8:95110988-95111010 ACAAGGCTTCACCTCCAAGGAGG - Intronic
1050180167 9:2913889-2913911 TGAAGGCTTCACCTCTATGGAGG + Intergenic
1051062403 9:13059445-13059467 AGAAGGCTGTGCTTGCATGAAGG + Intergenic
1051508909 9:17856094-17856116 AGAAGGCTGTACATGCCTGAAGG - Intergenic
1051701513 9:19829116-19829138 AGAAGGTATTGTCTCCATGATGG - Intergenic
1051922332 9:22282126-22282148 AGAACGCTTAACCTTCATAAAGG + Intergenic
1055067327 9:72131923-72131945 AGAAGGCTTCACAATCATGACGG + Intronic
1055838330 9:80472450-80472472 AAAATGTTTTACCTCAATGAAGG - Intergenic
1057440868 9:95082283-95082305 AGCAGGCATTCCCACCATGATGG - Intronic
1062208422 9:135349814-135349836 AGGAGGCTCTACTTCCAGGATGG - Intergenic
1186812332 X:13202474-13202496 AGAAACCTTAGCCTCCATGAGGG + Intergenic
1188558088 X:31434576-31434598 AGAAACCATAACCTCCATGAGGG + Intronic
1193106160 X:77676284-77676306 ATAAGGCTTCATCTCCTTGAGGG + Exonic
1195558147 X:106250854-106250876 TGGAGGCTTTATCTGCATGATGG + Intergenic
1195752213 X:108170557-108170579 AAAAGTCTTTCCCTCGATGAAGG - Intronic
1196504040 X:116419525-116419547 AGAAGGCTCTTGCTACATGAAGG - Intergenic
1199394104 X:147313703-147313725 AGGAGGGTTTATCTCCATAAAGG + Intergenic