ID: 1157733506

View in Genome Browser
Species Human (GRCh38)
Location 18:50025401-50025423
Sequence GTTTTTAAGGGGATCACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 1, 2: 22, 3: 60, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157733506_1157733518 13 Left 1157733506 18:50025401-50025423 CCCTCTGTGATCCCCTTAAAAAC 0: 1
1: 1
2: 22
3: 60
4: 216
Right 1157733518 18:50025437-50025459 TCCTCAAGGAGGTGGATTTAAGG 0: 1
1: 0
2: 8
3: 54
4: 211
1157733506_1157733512 -1 Left 1157733506 18:50025401-50025423 CCCTCTGTGATCCCCTTAAAAAC 0: 1
1: 1
2: 22
3: 60
4: 216
Right 1157733512 18:50025423-50025445 CTCCAGCCCGGAACTCCTCAAGG 0: 1
1: 5
2: 13
3: 58
4: 259
1157733506_1157733516 5 Left 1157733506 18:50025401-50025423 CCCTCTGTGATCCCCTTAAAAAC 0: 1
1: 1
2: 22
3: 60
4: 216
Right 1157733516 18:50025429-50025451 CCCGGAACTCCTCAAGGAGGTGG 0: 1
1: 0
2: 2
3: 24
4: 175
1157733506_1157733514 2 Left 1157733506 18:50025401-50025423 CCCTCTGTGATCCCCTTAAAAAC 0: 1
1: 1
2: 22
3: 60
4: 216
Right 1157733514 18:50025426-50025448 CAGCCCGGAACTCCTCAAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157733506 Original CRISPR GTTTTTAAGGGGATCACAGA GGG (reversed) Intronic
900531781 1:3157406-3157428 TTTTTTAATGGGATCGCAAAAGG - Intronic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902660383 1:17896749-17896771 GTTTTCCAGGGCATCCCAGAAGG + Intergenic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
906966849 1:50466072-50466094 AGATTGAAGGGGATCACAGATGG + Intronic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
908960405 1:69690809-69690831 CTTTTTAAGGGAATCATAGAGGG + Intronic
909124923 1:71655798-71655820 GTTGTGAAAGGCATCACAGAGGG + Intronic
909192117 1:72566714-72566736 GTTTTTAAGAAAATCACACAAGG + Intergenic
909279224 1:73727423-73727445 GTTTTTATGGGGAATAAAGAGGG + Intergenic
909475580 1:76077437-76077459 GTTTTTATGTGTACCACAGAGGG + Intronic
910034631 1:82776306-82776328 GTGTGGAAGGGGACCACAGAGGG + Intergenic
910185821 1:84538739-84538761 GCTTGTAAGGTGATCCCAGAGGG + Intergenic
911210931 1:95137333-95137355 GTCTTTAAGGGCAGCAAAGAAGG - Intronic
911245853 1:95516375-95516397 GTTTTCAACCGGATCAGAGAGGG + Intergenic
912102128 1:106222704-106222726 ATTTTTCAGAGGATCATAGAGGG - Intergenic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915848972 1:159300452-159300474 GTTTTTAAGGTGCTGTCAGAGGG - Intronic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
917093728 1:171379804-171379826 GTTTTTAAGGGTTTCAGAGTGGG - Intergenic
917104412 1:171478084-171478106 GTTTTTAAGGGTTTCAGAGTGGG - Intergenic
918217528 1:182405628-182405650 AGTTTTAAGGGGATCATGGAGGG - Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
918994009 1:191732536-191732558 GTGTGTAAGGGGATCCCAGCGGG - Intergenic
919382506 1:196876229-196876251 GACTTTAAGGGGATCATGGAGGG - Intronic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
921411328 1:214839319-214839341 GTTGTTATGGGGATAACATAGGG + Intergenic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
923662578 1:235971350-235971372 TTTGTTAAGGGGATCAGAGAAGG - Intergenic
923748447 1:236724802-236724824 ATTTTTATGGTCATCACAGATGG + Intronic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
1065409334 10:25406328-25406350 GTTTTTAGAGGGATCCCAGCAGG + Intronic
1066030828 10:31421957-31421979 GTGTCTAAGGGGATCAGAGGTGG - Intronic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069880770 10:71591562-71591584 CTCTTTAAGGGTATCACACATGG - Intronic
1071037956 10:81270007-81270029 GATTTTAAGGGGAGTAGAGAGGG + Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1071756897 10:88552334-88552356 GTTCTTAAGGAGCTCACAGTGGG - Intronic
1072319664 10:94236348-94236370 TTTTTTAAAGGGGTAACAGATGG - Intronic
1076091821 10:127693212-127693234 GTTGCTATGGGGGTCACAGAGGG + Intergenic
1077997457 11:7466328-7466350 GCTTTCAAAGGGCTCACAGATGG - Intronic
1080749609 11:35139807-35139829 GTTATCAAGGTGGTCACAGAAGG + Intronic
1084220607 11:67675289-67675311 GTTCTTGAGAGGGTCACAGAGGG + Intronic
1085613176 11:77971730-77971752 GTTTTTCAGGGGACCCAAGAAGG - Intronic
1086551815 11:88061272-88061294 GTGTTCAAGGGGATCACAAATGG + Intergenic
1086736406 11:90311263-90311285 GTGTTTCAGATGATCACAGAAGG + Intergenic
1088388068 11:109281768-109281790 GTTGTTAAGGGGGGCACAGTGGG - Intergenic
1089644445 11:119869405-119869427 GTGTGGAAGGGGATGACAGAGGG - Intergenic
1090563651 11:127962337-127962359 CTTTTTAAGGGATTCACAGTAGG + Intergenic
1091074706 11:132604503-132604525 GTTCATAAGGGCATCAGAGAGGG - Intronic
1092039863 12:5374612-5374634 CCTTTTATGGGGGTCACAGATGG - Intergenic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1094488701 12:30945222-30945244 GTTGATAATGGGAACACAGAGGG - Intronic
1096628822 12:52912409-52912431 GTTTTTAAAGGGATGACTGAGGG - Intronic
1097353661 12:58577300-58577322 GTTTTTAATGGGAGCCCAGAAGG + Intronic
1098033471 12:66278678-66278700 TTGTTTAGGGGGACCACAGAAGG - Intergenic
1098080129 12:66775172-66775194 GTTTTTAAGGAGCACAGAGAGGG + Intronic
1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG + Intergenic
1099004306 12:77218219-77218241 GGATTTGAGGGGATCAGAGAGGG + Intergenic
1100118262 12:91336137-91336159 GTTTTTAAGCTGACAACAGATGG + Intergenic
1100993320 12:100274287-100274309 TTTTTTAAGTTGATCACAGCTGG + Intronic
1105057596 12:133116725-133116747 TTTATTAAGGGAATCTCAGAGGG - Exonic
1105988129 13:25589574-25589596 GAATTTAAGGAGCTCACAGAAGG + Intronic
1106795867 13:33204985-33205007 GTTTTCAGGGGGCTCACAGGAGG - Intronic
1106883474 13:34157251-34157273 GTTTCTAAGGAGACCACTGAGGG + Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1111256427 13:85675635-85675657 GTCTTTAAAGGGATTAGAGAGGG - Intergenic
1112707248 13:102084656-102084678 GTTGTTGAGGCAATCACAGAAGG + Intronic
1115055327 14:29118979-29119001 ATTTTAAAGGAGATCAGAGATGG + Intergenic
1116214138 14:41988998-41989020 GATTTTGAGGGGGACACAGAAGG + Intergenic
1116666580 14:47783655-47783677 GATAATAAGGGGATAACAGATGG + Intergenic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1120159760 14:81133190-81133212 CTTTTTAAGGGGATCTCAGGAGG - Intronic
1123804253 15:23854887-23854909 GTTGCCAAGGGGATCAGAGAAGG + Intergenic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130689872 15:86072916-86072938 GTTTCTAAGCGGATCATGGAGGG - Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134315076 16:13111388-13111410 TTTCTTAAGGTGATCTCAGATGG + Intronic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1135499544 16:22981773-22981795 GTGTTTTAGGAGCTCACAGAGGG + Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138246797 16:55473228-55473250 GTTTTTAAGGGCATCTGAAACGG + Intronic
1138335217 16:56247396-56247418 GTTTTAAAGGGGCTCAGAGAAGG - Intronic
1139438562 16:66951323-66951345 GTTTTTCAGGGGATTAAACATGG - Intergenic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1142490866 17:278606-278628 GTTTATATGGGGATAAGAGAGGG - Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1145053284 17:19680918-19680940 GTTTTGTGGGGGATTACAGAGGG - Intronic
1146574082 17:33976785-33976807 ATGTTTAAGGGTATCACAGCAGG - Intronic
1148949400 17:51296891-51296913 GTTTTCAATTAGATCACAGAAGG - Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149170127 17:53799645-53799667 TTTTTTATGGAGTTCACAGAAGG - Intergenic
1149827034 17:59838067-59838089 GTTTTTAAGGGGTTGTTAGATGG + Intronic
1153279813 18:3404357-3404379 TATTTTAATGGGATCTCAGAAGG - Intergenic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1156518452 18:37700763-37700785 GTTTTAAATGTGAACACAGATGG + Intergenic
1156585180 18:38424050-38424072 ATTTGTAAGGGGAGCAAAGATGG - Intergenic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157366953 18:47073961-47073983 GTTTTTAAGGTGCTCACTAAAGG - Intronic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1158057346 18:53297339-53297361 ATTTTTATGGTGATCAAAGAGGG + Intronic
1158091469 18:53718778-53718800 ATTTTTAAGGCAAACACAGAAGG + Intergenic
1158422988 18:57312701-57312723 GGTTTTTAGGGGATCCCAGAAGG - Intergenic
1158828391 18:61250841-61250863 GATTTTCTGGGGATCAAAGAAGG - Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159869545 18:73744791-73744813 GTTTTTAAGGCTATTACAAAAGG - Intergenic
1160539977 18:79615608-79615630 GTTTTTAAATGGATCAGAAAAGG + Intergenic
1160623805 18:80189272-80189294 TTTTTAAAGGAGATCACAGAAGG + Intronic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162326516 19:10002840-10002862 GATTTTCAGGGGGTCGCAGATGG - Intronic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1167346263 19:48947289-48947311 GCTTTTATGGGCCTCACAGAGGG - Intergenic
1168517958 19:57024237-57024259 GTTATGTAGGGGTTCACAGAGGG + Intergenic
1168533660 19:57150899-57150921 GTTTTTGTGTGTATCACAGATGG + Intergenic
925747513 2:7056309-7056331 GGTTGTAAGGGAAGCACAGAGGG - Intronic
927085799 2:19673047-19673069 ATTCTTAGGAGGATCACAGAAGG - Intergenic
927601825 2:24449603-24449625 TTTTTAAAAGGGATCACACATGG + Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930297316 2:49570972-49570994 GTTTTTAAGGGGTACATAGGAGG + Intergenic
930350252 2:50243719-50243741 ATTTTTAAGGGGATCAGAGGAGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
930833521 2:55770834-55770856 TTTTTTAAGGGGATCCCAGAAGG + Intergenic
932546286 2:72714034-72714056 GCTTTCAAGGGTACCACAGAAGG - Intronic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
933115918 2:78471296-78471318 GTCTTTAGGGGTATCATAGAAGG - Intergenic
934860341 2:97759390-97759412 GTATTGAAGGGCTTCACAGAAGG - Intronic
935280879 2:101516808-101516830 GTTTTTAAGGGTTTCAGAGTGGG - Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939476169 2:142689902-142689924 ATTTTTAATGGGATAATAGATGG - Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
940451735 2:153845647-153845669 GTATTTTAGGGGTTCCCAGAAGG + Intergenic
941373041 2:164691368-164691390 GCTTTTAAAATGATCACAGAAGG + Intronic
941771114 2:169347077-169347099 GTTTTAATGGGGATGAAAGAGGG - Intronic
941783997 2:169478747-169478769 GTTTTTAAGAGGATCACAGAGGG - Intergenic
942603240 2:177662954-177662976 GTTTTTAATGGGGTTACATAGGG + Intronic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
943534314 2:189128131-189128153 GTATTTAATGGAATCACAGCTGG + Intronic
944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG + Intronic
946862373 2:224012818-224012840 GTTCTAAAGGGGAGCAGAGAAGG + Intronic
947238739 2:227971431-227971453 ATTTTTCAGTGGATCGCAGAGGG - Intergenic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
948578020 2:238966519-238966541 CTTTTAAAGGGGATGGCAGAGGG + Intergenic
948757816 2:240169395-240169417 GTTTCTAAGGTGCTCACCGAAGG - Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1169312236 20:4553820-4553842 GTTATTCAGGGGATTCCAGATGG + Intergenic
1170717940 20:18848086-18848108 GTTTTGAAGGGGATCTTAGCAGG + Intergenic
1171312810 20:24159320-24159342 GTTTTTAAGGGGATGCCTCAAGG + Intergenic
1173392810 20:42649951-42649973 CTTTATAAGGGGACCACAGTTGG - Intronic
1178106493 21:29324930-29324952 GTTTTTAAGAAGATCACAGCCGG + Intronic
1179087070 21:38227411-38227433 GTTGTTAAGTAGTTCACAGATGG - Intronic
1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
952466198 3:33588793-33588815 GTTTTTAAATGGATGGCAGATGG + Intronic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
953291903 3:41673797-41673819 GTTGGTAAGGGGAACAGAGAAGG - Intronic
954441993 3:50527028-50527050 GTTCTTAAGGGGGTCTCAGCAGG + Intergenic
954670518 3:52288870-52288892 GTTGTGAAAGGGAACACAGAGGG - Intronic
956456972 3:69431086-69431108 GTTTTAGAGGGAATCAAAGAAGG + Intronic
956578319 3:70780865-70780887 CTTTCTGATGGGATCACAGAAGG + Intergenic
956642394 3:71427460-71427482 GTTTGCAAGGAGATCACAGAAGG + Intronic
957303535 3:78425232-78425254 TTTTTTAATGGGAGGACAGAAGG - Intergenic
958935208 3:100249397-100249419 GTTTTTAAGGAGCTAACAGCTGG - Intergenic
959942330 3:112092468-112092490 GTTTATGAGGGTGTCACAGAGGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
963353826 3:144185361-144185383 GTTTTTAAAAGGATCATAAAGGG - Intergenic
963500691 3:146121689-146121711 GTTTTTCAGGGAATTGCAGAGGG + Intronic
965490386 3:169327880-169327902 GTATTTAAGGGCTTCAAAGAAGG - Intronic
966442130 3:179957377-179957399 GCTTTTGGGAGGATCACAGAAGG + Intronic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
969677575 4:8622653-8622675 GTTTTTAAAGGGAAAACACAAGG + Intergenic
969678530 4:8628294-8628316 GTTTTTAAAGGGAAAACACAAGG + Intergenic
969679486 4:8633928-8633950 GTTTTTAAAGGGAAAACACAAGG + Intergenic
970149818 4:13077335-13077357 GTTTTTAAGGGCATCTGAAATGG - Intergenic
971793226 4:31195900-31195922 GTTTTTCAGGGGACTACACAAGG - Intergenic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
973855755 4:55008647-55008669 GTTTGTAAGGGCATCACGAAAGG - Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974991434 4:69095255-69095277 GGTTTTAAGGAGATCATAGATGG + Intronic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
975618863 4:76275678-76275700 GTTTACAAAGGCATCACAGAAGG + Intronic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
978751834 4:112258568-112258590 ATTTTTAAGGGGATAACACCTGG + Intronic
979556364 4:122051918-122051940 GTTTTTCAGGGGATGACAGACGG + Intergenic
981888657 4:149710541-149710563 TTTATTAATGGGAGCACAGATGG - Intergenic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
984654153 4:182299467-182299489 GTTTTTAAAGGCAAAACAGAAGG + Intronic
984704708 4:182839386-182839408 TTTTTTGGGGGGACCACAGATGG - Intergenic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
986487028 5:8247938-8247960 GTTTTTAGCTGGATCACAGGTGG + Intergenic
986522971 5:8641614-8641636 GTTTTTAATGGGGCCACAGCTGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
991076906 5:62550436-62550458 GTTTTCAAGGGTATTATAGAAGG + Exonic
991458862 5:66835051-66835073 GGTTTCAAGGGGAGCAGAGATGG - Intronic
991590815 5:68249882-68249904 GTTCTTTAGGGGTTCCCAGATGG - Intronic
993167326 5:84373989-84374011 GTTTTTAAGGGGACGAATGATGG + Intronic
993220413 5:85088451-85088473 GTTTTCAATGGGACCACAAAAGG + Intergenic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
996199420 5:120652544-120652566 GTTTTTGAGAAGACCACAGAGGG - Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
998054421 5:139062215-139062237 GTTTTTAAGGGAACCAAAAATGG + Intronic
998652307 5:144134585-144134607 ATGTTTAATAGGATCACAGATGG - Intergenic
999195375 5:149778223-149778245 GTCTTGGAGGGGATGACAGAAGG + Intronic
1000217012 5:159169041-159169063 TTTTTTAGGGGCATGACAGAAGG - Exonic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1004122393 6:12836976-12836998 GTTTTAAAGAGGAACATAGAGGG - Intronic
1004251730 6:14028506-14028528 GTTTTGATGGGGATAACAGGAGG - Intergenic
1006030193 6:31172179-31172201 GTCTTTGAGGGGATTGCAGAGGG - Intronic
1006330695 6:33388556-33388578 GTCTTTCAGGGGAGGACAGATGG - Intergenic
1008382814 6:50852986-50853008 GTTTTTAGGTGGATGAAAGAGGG - Intergenic
1009403168 6:63280175-63280197 AGTTTTAAAGGGATCTCAGAAGG + Exonic
1012812209 6:103973218-103973240 GTTTTTAACAAGATCACAGTGGG - Intergenic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1017629376 6:156381494-156381516 GATTTGAAGGGGATCACACTGGG - Intergenic
1018258537 6:161946606-161946628 GTTTTTTGGTGGATCTCAGAAGG - Intronic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1020475070 7:8584577-8584599 GTATTAAATGGTATCACAGAGGG + Intronic
1020971908 7:14954054-14954076 CTTTATTAGGGGATCAAAGAAGG + Intronic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1022137690 7:27465096-27465118 GTCTTCATGGGGATTACAGATGG - Intergenic
1022624656 7:32022529-32022551 TGGTTTAAGGGGAGCACAGAAGG + Intronic
1023202343 7:37712259-37712281 GTTATCAAGGGGATCACAGGTGG - Intronic
1026213838 7:68330703-68330725 GTGTTTAAGGAAATCACGGAGGG - Intergenic
1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027497993 7:78911956-78911978 GTCTTTTACGGGAACACAGATGG + Intronic
1029101825 7:98137434-98137456 GACTTTAAGGTGAGCACAGAGGG + Exonic
1029175867 7:98664117-98664139 GTTTTTAAGGGAATCATAAAGGG - Intergenic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1035070965 7:156144534-156144556 GGCTTCAATGGGATCACAGACGG - Intergenic
1035532649 8:365590-365612 ATTTCTAAGGGGACCACAGATGG + Intergenic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1039147289 8:34463173-34463195 GTTTTTATGGGGAGCAAAAAGGG - Intergenic
1039152566 8:34523415-34523437 TTTTTTAAGGTGAATACAGATGG - Intergenic
1039654239 8:39382010-39382032 GTTTTTCAGGGGATCAGAGGAGG - Intergenic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041808448 8:61881558-61881580 TTTCTTCAGGGGAGCACAGAAGG + Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1045560447 8:103256773-103256795 TTTTTTAAGTGAATCAGAGATGG - Intergenic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1045962161 8:107980817-107980839 GTTATAGAAGGGATCACAGAAGG - Intronic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1048959277 8:139562401-139562423 TTTTTTAAAGGGACCACAGATGG - Intergenic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050049386 9:1583353-1583375 GTTTTCAAGGCTACCACAGATGG + Intergenic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1055573281 9:77638726-77638748 GTTTTTAAATGGACCAAAGAAGG + Intronic
1056747232 9:89313333-89313355 GTTTCTAAGGGCATAACAGTGGG + Intronic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1057578003 9:96259393-96259415 GTTGTTGTGGGGATCATAGAAGG + Intronic
1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG + Intergenic
1059524736 9:114980192-114980214 GTTTACAAGGGGATGAGAGAAGG + Intergenic
1060473396 9:123967357-123967379 ATCCTTCAGGGGATCACAGAAGG + Intergenic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1185907597 X:3950392-3950414 GTTTTTCAGGAGAACAAAGAGGG + Intergenic
1189198936 X:39175371-39175393 CTTTTTGAGGGGATCACAGGAGG + Intergenic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1191732272 X:64349784-64349806 GTTTTTGAGAGGATCTCAGTAGG - Intronic
1192178830 X:68902825-68902847 GTTCCTAAGGGCAACACAGAGGG + Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1194140266 X:90200203-90200225 GTTTTTCAGTGGAGCAAAGATGG - Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1196180220 X:112681294-112681316 GTTCTTAAGGGAATGACAGCTGG - Intergenic
1197884574 X:131204937-131204959 GTTGATAAGGGGATTACACATGG - Intergenic
1198888439 X:141365481-141365503 GTTTTTAAGGACATCACAGTAGG - Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1200486011 Y:3769169-3769191 GTTTTTCAGTGGAGCAAAGATGG - Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic