ID: 1157737439

View in Genome Browser
Species Human (GRCh38)
Location 18:50062693-50062715
Sequence GGGTTCAGGATGCGGTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157737439_1157737446 6 Left 1157737439 18:50062693-50062715 CCCAGACACCGCATCCTGAACCC 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1157737446 18:50062722-50062744 GATGATTAGTCCTGCAAATTTGG 0: 1
1: 0
2: 0
3: 3
4: 88
1157737439_1157737448 8 Left 1157737439 18:50062693-50062715 CCCAGACACCGCATCCTGAACCC 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1157737448 18:50062724-50062746 TGATTAGTCCTGCAAATTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 126
1157737439_1157737447 7 Left 1157737439 18:50062693-50062715 CCCAGACACCGCATCCTGAACCC 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1157737447 18:50062723-50062745 ATGATTAGTCCTGCAAATTTGGG 0: 1
1: 0
2: 0
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157737439 Original CRISPR GGGTTCAGGATGCGGTGTCT GGG (reversed) Intronic
900682301 1:3923788-3923810 AGGTTCAGGACGAGGTGTCCTGG - Intergenic
903049278 1:20588972-20588994 GCTTTCAGGATGCAGGGTCTAGG - Exonic
906642534 1:47450055-47450077 GCGCTCAGGATCCGGTGTCAGGG - Intergenic
908481827 1:64548095-64548117 GGGTTCAGGAGGCTGTGTTTTGG - Intronic
912905620 1:113703432-113703454 GGGTACAGGAGGGGGTTTCTAGG + Intronic
913676887 1:121149343-121149365 GGGCTCAGGAGGTGGTGACTGGG + Intergenic
914028780 1:143937295-143937317 GGGCTCAGGAGGTGGTGACTGGG + Intergenic
916121745 1:161534305-161534327 GTGTTCAGGCTGCCCTGTCTTGG + Intergenic
916131338 1:161614251-161614273 GTGTTCAGGCTGCCCTGTCTTGG + Intronic
918407560 1:184225890-184225912 GGGTTTAGGATGCAGGTTCTCGG + Intergenic
920464244 1:206168185-206168207 GGGCTCAGGAGGTGGTGACTGGG + Intergenic
1073105078 10:101028076-101028098 GGTTCCAGGCTGCGGTGACTTGG + Intronic
1075045021 10:119139841-119139863 GGGTTGAGTTTGAGGTGTCTGGG + Intergenic
1076130956 10:128013597-128013619 GGGTTGAGGAGGCGGGGCCTTGG + Intronic
1076387799 10:130070597-130070619 GGGCTCAGGGTGCAGTGTTTTGG - Intergenic
1084270360 11:68026235-68026257 GGGAGCAGGATGCGGGTTCTGGG - Intronic
1088357740 11:108960973-108960995 GGCTTCAGCATGGGCTGTCTGGG + Intergenic
1090198638 11:124838716-124838738 GGGAGCAGGGTGCAGTGTCTCGG - Intergenic
1090456178 11:126851601-126851623 GGGTTCAGGATGTGGTTCCCAGG - Intronic
1091042611 11:132296148-132296170 GAATTCAGCCTGCGGTGTCTGGG + Intronic
1091817893 12:3453583-3453605 GGGCTGAGAATGAGGTGTCTGGG + Intronic
1092253408 12:6914050-6914072 GGGTGCAGAATGGGGTGCCTAGG + Exonic
1094155519 12:27333354-27333376 GCGCTCAGGACGCGGTGTCTTGG + Intronic
1096386548 12:51198413-51198435 GGAGTCTGGATCCGGTGTCTTGG - Intronic
1096686579 12:53292092-53292114 GGGTTCAGGGCGTAGTGTCTGGG + Intronic
1101869997 12:108558305-108558327 GGGATCAGGATGAGGTGGGTGGG + Intronic
1102722984 12:115034121-115034143 GGGTTCTGGGTGTGGTGTCATGG - Intergenic
1106541800 13:30697064-30697086 GAGTTATGGGTGCGGTGTCTGGG + Intergenic
1112386714 13:98946576-98946598 GGGTTCCGCATGGGGTCTCTGGG - Intronic
1118904550 14:70014166-70014188 GGGCTAAGGATGAGGTATCTGGG + Intronic
1122066166 14:99175655-99175677 GGGTTCAGGAGCCGGTGCATAGG + Exonic
1128732555 15:70031018-70031040 GGGGCCAGCATGCTGTGTCTAGG + Intergenic
1129119348 15:73386287-73386309 GGGTTCTGGCTGGTGTGTCTGGG + Intergenic
1129160658 15:73746001-73746023 GGGTACAGGATGCTGGTTCTGGG - Intronic
1129486315 15:75876179-75876201 TGTTTCAGGGTGCAGTGTCTGGG + Exonic
1130505741 15:84539774-84539796 TGTTTCAGGCTGCAGTGTCTGGG - Intergenic
1131379874 15:91954814-91954836 CGGTTCAGGGTATGGTGTCTAGG - Intronic
1132560436 16:590884-590906 GGGTGCAGGATCTGGGGTCTGGG + Intronic
1133020876 16:2966530-2966552 AGGTTCAGAAACCGGTGTCTGGG - Intronic
1133287091 16:4695554-4695576 GGGTGGAGGATGCCTTGTCTCGG + Exonic
1135894384 16:26385628-26385650 GGTTTCAGGATTAGGTCTCTAGG - Intergenic
1136248107 16:28986461-28986483 GGGTTCAGGCGGCGGGGGCTGGG + Intronic
1139403066 16:66697007-66697029 GGGTTCAGGCAGCGGGGTCTTGG + Intergenic
1142136116 16:88452826-88452848 GGGCGCAGGATGCGGTGCCGCGG + Intergenic
1142749338 17:1978002-1978024 GGGTGCAGGATGCGGGGTGCGGG - Intronic
1146059643 17:29597769-29597791 GGGTTCTGCATGGGGTGTATGGG + Intronic
1147188948 17:38727986-38728008 GTGTTCTGGGTGGGGTGTCTTGG - Exonic
1147253332 17:39166406-39166428 GGGATCAGGAAGCTGTGCCTGGG - Intronic
1148858869 17:50593718-50593740 TCACTCAGGATGCGGTGTCTTGG + Intronic
1152067798 17:78121171-78121193 GGGTGCAGGGAGCGGTGTCATGG + Intronic
1152310572 17:79547535-79547557 GGGTTCAGGAGGGCTTGTCTGGG - Intergenic
1153835337 18:8959019-8959041 GTGTTCAGCCTGCTGTGTCTCGG - Intergenic
1157737439 18:50062693-50062715 GGGTTCAGGATGCGGTGTCTGGG - Intronic
1158507240 18:58057580-58057602 GGCTTCAGGATTGGTTGTCTTGG + Intronic
1160574578 18:79845255-79845277 GGGTTCAGGAGGAGGTGGCTGGG + Intergenic
1160575200 18:79849170-79849192 GGGTCCAGGCTGCGAGGTCTGGG - Intergenic
1162675284 19:12294274-12294296 GGTTTGAGGATGGGGTGTTTAGG - Intronic
1164638913 19:29811343-29811365 GGCTTCAGGCCGCGGGGTCTGGG - Intergenic
1164862025 19:31569122-31569144 GTGTCCAGGATTCTGTGTCTAGG - Intergenic
1165846221 19:38819397-38819419 GGGGTCAGGATGCGGGGGATGGG - Intronic
1168266410 19:55226118-55226140 GGCTTGAGGATGAGGGGTCTTGG - Intergenic
927909430 2:26885966-26885988 GGTTTCTGGATGGGGTGACTGGG + Intronic
930561016 2:52959909-52959931 AGGCTCAGGATGCGGTGGGTGGG + Intergenic
938248648 2:129797408-129797430 GGGTTCAGGATTTGGACTCTGGG - Intergenic
938426914 2:131200656-131200678 GGGTTCAGGCTGCGCTGCTTTGG - Intronic
947546259 2:231012326-231012348 GGGGTCAGGATGAAGGGTCTGGG + Intronic
1171077692 20:22145648-22145670 GGGTTCATCATGTGGTTTCTTGG + Intergenic
1172445852 20:34993097-34993119 GGGTTCAGGATACGGTACCTGGG - Exonic
1177647415 21:23917482-23917504 GGGTACAGGATACGGAGTCATGG - Intergenic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1178487672 21:33029233-33029255 GGGTTCAGGACGCGATACCTTGG + Intergenic
1179781606 21:43704469-43704491 GGTATCAGGATGTGGGGTCTTGG - Intergenic
1184113454 22:42408825-42408847 GAGTGCAGGATGGGGTGGCTTGG - Intronic
1184510942 22:44932805-44932827 GGGTTGGGGATGGGGTGACTGGG - Intronic
950043165 3:9933205-9933227 GGCTACAGGATGGGGTGTCCGGG + Exonic
950434076 3:12967982-12968004 GGGACCTGGATGCAGTGTCTGGG - Intronic
950581107 3:13862655-13862677 GGGTGCAGGGAGCTGTGTCTGGG + Intronic
954613769 3:51959328-51959350 TGGTTCAGGAAGGGGTGCCTTGG + Intronic
962820733 3:139045187-139045209 GGGTTTAGGATTCGGTGTCCTGG - Intronic
967174744 3:186853050-186853072 GGGCTCAGGATGCTGTTGCTGGG + Exonic
967979419 3:195056717-195056739 GGGTTCAGGTTGCAGAGCCTGGG - Intergenic
971217437 4:24674189-24674211 GGCTTCAGAATGGGGTGTGTAGG + Intergenic
972016967 4:34259435-34259457 GGGTTAAGAATGTGGTCTCTGGG - Intergenic
981550312 4:145936743-145936765 GGGTTAAGGTTATGGTGTCTCGG - Intronic
985269867 4:188183834-188183856 GAGTACAGGATGCGGGGTCAGGG - Intergenic
987547547 5:19332405-19332427 GGGTTCAGGATTCTGTTTATGGG + Intergenic
991087419 5:62660847-62660869 GGGTACAGGATGGGGTGGCATGG - Intergenic
993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG + Intergenic
994168791 5:96636914-96636936 GGGGTCAAGATGCGGTGTTGGGG + Intronic
998983100 5:147726133-147726155 TGTTTCAGCATGTGGTGTCTGGG - Intronic
999062252 5:148648458-148648480 AGGATCAGGATGTTGTGTCTGGG + Intronic
1000994194 5:167942475-167942497 GGGTTCAGGAGGCCATTTCTAGG - Intronic
1004510251 6:16278906-16278928 GGGCTGAGGCTGGGGTGTCTTGG + Intronic
1004844789 6:19627967-19627989 GGATTCAGGATAATGTGTCTAGG - Intergenic
1005899882 6:30207946-30207968 GGGTGCAGCATGGGGTGTTTTGG - Intronic
1017703114 6:157095076-157095098 GGGTTCAGGATGAGGTCCCCTGG + Intronic
1023201563 7:37703322-37703344 GGTTTCACTATGCTGTGTCTAGG + Intronic
1023743817 7:43303736-43303758 GGTTTCAGGAACAGGTGTCTGGG + Intronic
1023989189 7:45117969-45117991 GGGTACAGGCTGGGCTGTCTTGG + Intergenic
1025959835 7:66210207-66210229 GAGTTCAGGCTTGGGTGTCTGGG + Intronic
1025997140 7:66535044-66535066 GGGTTCAGAAGGAGGGGTCTTGG + Intergenic
1029218519 7:98969786-98969808 GGGTTCAGGAGGACGAGTCTGGG + Intronic
1030156359 7:106459867-106459889 GGTTTCAACATGCGGTCTCTGGG + Intergenic
1034951464 7:155299147-155299169 GGGTTCAGGAGGCGGTTGCCAGG + Intronic
1035130491 7:156648197-156648219 TGGTTGAGGATGGCGTGTCTTGG + Intronic
1035230608 7:157463681-157463703 GGGATGAGGATGCGGTGAATGGG - Intergenic
1038459432 8:27703426-27703448 GGGGACAGGATGGGGTGGCTGGG + Intergenic
1048210827 8:132453071-132453093 GAGTTAAGGGTGCGGTCTCTCGG + Intronic
1062013019 9:134276956-134276978 GGGCTCCGGATGCCGTGGCTGGG + Intergenic
1062399165 9:136364978-136365000 GTGCTCGGGGTGCGGTGTCTGGG - Intronic
1062529478 9:136993612-136993634 GGAGTCAGGAGGCGGTGTCCAGG + Exonic
1062532944 9:137009679-137009701 GCGTTCAGGCTGGGGTGTGTGGG - Intronic
1185736902 X:2501638-2501660 GGGTTCTTGGTGGGGTGTCTGGG - Intronic
1187446308 X:19364216-19364238 GGTTTCAGGAGGCGGTCCCTTGG - Intronic
1190990965 X:55549844-55549866 CAGTGCAGGATGCTGTGTCTTGG + Intergenic
1197563508 X:128052361-128052383 AGGTTGAGGATGGGGTGTCCTGG - Exonic
1197719425 X:129735007-129735029 GGGTTAAGGATGGGGAGGCTAGG + Intergenic
1197724643 X:129768416-129768438 AGGCCCAGGAGGCGGTGTCTGGG - Exonic
1202364220 Y:24144848-24144870 TGTTTCAGGCTGCAGTGTCTGGG + Intergenic
1202506560 Y:25525274-25525296 TGTTTCAGGCTGCAGTGTCTGGG - Intergenic