ID: 1157737845

View in Genome Browser
Species Human (GRCh38)
Location 18:50066286-50066308
Sequence GTTTGTATGGGGATAGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157737845_1157737853 19 Left 1157737845 18:50066286-50066308 CCTACCACTATCCCCATACAAAC 0: 1
1: 0
2: 1
3: 16
4: 185
Right 1157737853 18:50066328-50066350 CTGAATATTCCTTTTTTATTTGG 0: 1
1: 0
2: 5
3: 51
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157737845 Original CRISPR GTTTGTATGGGGATAGTGGT AGG (reversed) Intronic
901808706 1:11753591-11753613 GCTTGGATGGGGGCAGTGGTGGG + Intronic
903674013 1:25053191-25053213 GTGTGTGTGGGGATGGGGGTGGG - Intergenic
905057200 1:35106284-35106306 GTCTGTATAGGGATAGAGTTGGG - Intronic
906592066 1:47034529-47034551 GTTTGTATGGGAACAGGGATGGG - Intronic
910931830 1:92450478-92450500 GTCTGCATGGGGGTAGGGGTGGG - Intergenic
911237335 1:95425521-95425543 GTTTGAATGGGGAAATTGGCTGG + Intergenic
912465033 1:109866535-109866557 GTGTGTATGGGGATGGGGGTGGG + Intergenic
913214689 1:116610569-116610591 GTTAGGATGGGGGTAGGGGTAGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914963464 1:152228609-152228631 GTGTGGCAGGGGATAGTGGTGGG + Intergenic
915167968 1:153959068-153959090 GTTTGTTTTGGGAAAGGGGTGGG - Intergenic
918889195 1:190243039-190243061 GTTTACATGGGGATAGTTGAGGG - Intronic
919113234 1:193246279-193246301 TTTTGTATGGGGTGAGAGGTAGG + Intronic
920020485 1:202952172-202952194 CTTTGTATGGGGGTAGAGGTGGG - Intronic
920426551 1:205881493-205881515 TTTTGTATAGGGTGAGTGGTGGG + Intergenic
922750746 1:228069013-228069035 TTCTGTAGGGGGATAGTGGAGGG + Intergenic
924136039 1:240967989-240968011 GTTTGGATATGGATATTGGTTGG - Intronic
1069035811 10:63645041-63645063 GTTTGGATGGGTGTTGTGGTTGG + Intergenic
1069337270 10:67366833-67366855 GTTTGTATGTAGTTAGAGGTAGG - Intronic
1071490322 10:86131840-86131862 GTTTGTGTGGGGACAGAAGTCGG + Intronic
1072256030 10:93621135-93621157 GTGTGTGTGGGGAGAGTGGCGGG - Intronic
1073817289 10:107222007-107222029 GTTTGTATGGTGATACGGCTTGG - Intergenic
1076257196 10:129037041-129037063 GTGTGTATGGCAGTAGTGGTGGG + Intergenic
1076544594 10:131236863-131236885 GCTTGTGTGGGGACAGTGGATGG - Intronic
1079499170 11:21083157-21083179 GTTTTTATGGGGCCATTGGTAGG + Intronic
1081296183 11:41392536-41392558 GTTTGTTTGGGGGAGGTGGTGGG - Intronic
1084805004 11:71572688-71572710 GTGGGTCTGGGGATGGTGGTGGG - Intergenic
1086018679 11:82199107-82199129 GTTTGTATGTGGAAGGTGCTGGG + Intergenic
1086157532 11:83684056-83684078 GTTTTTATGGGTTTTGTGGTAGG - Intronic
1086323890 11:85678929-85678951 GTTTGCATGGGAATGGTGGTGGG + Intronic
1087575005 11:99978834-99978856 GTTTATATGGGAAGAGAGGTAGG + Intronic
1091957858 12:4662986-4663008 GGTTGTCTGGGGTTAGGGGTGGG - Intronic
1092315239 12:7405422-7405444 TTTTGAATGGTGAAAGTGGTTGG + Intronic
1092917599 12:13202638-13202660 GTTTGCAGGGGGATATTGTTCGG + Intronic
1096118327 12:49069461-49069483 GTTACTTTGGGGATAGGGGTGGG - Intronic
1096644340 12:53021932-53021954 ATTTGAATAGGGGTAGTGGTGGG + Intronic
1097322363 12:58240402-58240424 GTGTGTGTGGGGATAGGGGTTGG + Intergenic
1099986607 12:89672691-89672713 GTGGGTGTGGAGATAGTGGTTGG - Intronic
1100956843 12:99918062-99918084 GCTGGGATGGGGAGAGTGGTTGG - Intronic
1103267966 12:119646878-119646900 GTTTGTATGGGGATATCTTTTGG + Intergenic
1103759798 12:123240451-123240473 GTTTGCATGGGGAGACTGGCTGG + Intronic
1105218416 13:18304048-18304070 GTTAGGATGGGGGTAGGGGTAGG - Intergenic
1105416432 13:20216876-20216898 GTTTGTATGGGTCTAGTTCTGGG - Intergenic
1105568549 13:21576800-21576822 TTTTGTATAGGGTTAGGGGTGGG - Intronic
1109853481 13:68099738-68099760 GGTTTTATGGGGATTGTGGTGGG + Intergenic
1110031030 13:70614295-70614317 GTGTGTATGTTGGTAGTGGTGGG - Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1113986976 13:114325111-114325133 GGATCTCTGGGGATAGTGGTGGG - Exonic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1119603868 14:75997745-75997767 GTTTGTTTGGGGGTGGGGGTTGG + Intronic
1124962337 15:34408435-34408457 GTTTGTGTGTGTATGGTGGTGGG - Intronic
1124978961 15:34554657-34554679 GTTTGTGTGTGTATGGTGGTGGG - Intronic
1125106212 15:35974451-35974473 CTTTGTATGGGGATTGTTTTTGG - Intergenic
1125521990 15:40353386-40353408 GTTTGTATGAAGGCAGTGGTAGG + Intronic
1128560087 15:68658976-68658998 GTATGCATGTGGATATTGGTGGG - Intronic
1129379161 15:75154596-75154618 GTTTGCATGGGGATGACGGTGGG - Intergenic
1130422435 15:83761942-83761964 GTTTGTATGGGGATTGTCACTGG + Intronic
1130710870 15:86279749-86279771 GTAGGTATAGGGATAGTGGTAGG - Exonic
1131452056 15:92549987-92550009 GGTTGGAGGGGGATAGTGGTTGG - Intergenic
1131789718 15:95951093-95951115 GTTTATATGGGGGTGGGGGTGGG - Intergenic
1133041957 16:3065596-3065618 GGTTTTATGGGGAAAGTGGGGGG - Exonic
1134670008 16:16047829-16047851 GTTTTTCTGGGGGGAGTGGTGGG - Intronic
1136271460 16:29151284-29151306 GTTTGTATGTGGCGAGAGGTAGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138096410 16:54215286-54215308 GTTTGCCTGGGGATGGTGCTGGG + Intergenic
1140916987 16:79502778-79502800 GTTTGCCTGTGGAGAGTGGTAGG + Intergenic
1141355980 16:83347358-83347380 GTTTGGGTGGGGGTAGGGGTTGG + Intronic
1141805261 16:86337577-86337599 GTGTGTTTGGGGATAGCTGTGGG + Intergenic
1142065887 16:88062560-88062582 GCTTGGTTGGGGACAGTGGTTGG - Intronic
1143363573 17:6390656-6390678 TTTTGTATGGTGACAGGGGTAGG - Intergenic
1143703950 17:8683602-8683624 GTGTGTGTGGTGATGGTGGTGGG - Intergenic
1145722218 17:27083659-27083681 GTCTGTGTGGGCATAGTGGTGGG + Intergenic
1150197889 17:63320032-63320054 AATTGTATTGGGATGGTGGTAGG - Intronic
1151375321 17:73684504-73684526 GTTGGTATGGGTACAGGGGTGGG + Intergenic
1151976325 17:77485341-77485363 GTGTTGATGGTGATAGTGGTGGG + Intronic
1153562535 18:6385559-6385581 CTTTGAATGGAGATGGTGGTAGG - Intronic
1154359334 18:13645872-13645894 GTTTATTTGGGGACAGGGGTTGG + Exonic
1157737845 18:50066286-50066308 GTTTGTATGGGGATAGTGGTAGG - Intronic
1158263766 18:55637361-55637383 TTTAGTATGGGGGTAGGGGTGGG - Intronic
1159621075 18:70639057-70639079 TTTTGTATGTGGATAGAGATAGG + Intronic
1163050835 19:14682515-14682537 TTTTTTAGGGGGATAGAGGTTGG + Intronic
1163675701 19:18654296-18654318 GTTGGTAGATGGATAGTGGTAGG - Intronic
1164908169 19:31984587-31984609 GTTTGGAGGAGGAAAGTGGTAGG - Intergenic
1165149849 19:33753936-33753958 GTTGGTGTGGGGATGGTGGGAGG - Intronic
1166338542 19:42123122-42123144 ATGTGGATGGGGAAAGTGGTGGG - Intronic
927279304 2:21289873-21289895 GTTTGTGTGGGGGTAGGGGCAGG + Intergenic
928923298 2:36548992-36549014 GTTTGGATGGGGAAATGGGTGGG + Exonic
928957668 2:36888007-36888029 GATTGGATGGGGAGAGAGGTTGG - Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
932309124 2:70725772-70725794 GTTTGTATGTACATTGTGGTTGG - Intronic
932961388 2:76416021-76416043 GTTTTTATGGGGTTTGTGGGAGG - Intergenic
933232297 2:79822904-79822926 ATCTGAATGGGGATGGTGGTAGG - Intronic
934295889 2:91742585-91742607 GTTAGGATGGGGGTAGGGGTAGG + Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
935116776 2:100143752-100143774 GTTTGGATGAGGATAATGGAGGG - Intergenic
937718599 2:125063943-125063965 GTTTGTGTGGGGAGGGTGGTTGG + Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
939591628 2:144071283-144071305 GTTTCGAGGGGGATAGGGGTTGG + Intronic
941062894 2:160868243-160868265 GTTTGCCTGGGGATTGGGGTGGG + Intergenic
941246688 2:163106692-163106714 GTTTTGATGTTGATAGTGGTAGG - Intergenic
941391616 2:164921943-164921965 GTGTTTATGGGGGTTGTGGTTGG + Intronic
941523031 2:166572401-166572423 GTTTTTCTGGGCATGGTGGTGGG - Intergenic
943132688 2:183874480-183874502 TTATGAATGGGGATAGAGGTGGG + Intergenic
943363501 2:186948044-186948066 GTTTGCCTGGGGCTAGGGGTGGG - Intergenic
944046023 2:195413211-195413233 GTTTGTGTGGGGAGGATGGTTGG - Intergenic
944068710 2:195646629-195646651 GTCTGTAGGGGGTTGGTGGTGGG - Intronic
947796536 2:232896955-232896977 GTGAGGATGGGGGTAGTGGTGGG + Intronic
1170530077 20:17282220-17282242 GTGTGTATGGAGAGAGAGGTAGG - Intronic
1171459084 20:25288518-25288540 TTTGGTCTGGGGATAGTGGGTGG + Intronic
1171986634 20:31665487-31665509 GTTAGTGTGGGGAGAGTGGGGGG + Exonic
1172283744 20:33726309-33726331 GTGTGTGTGGGGGTGGTGGTGGG + Intergenic
1173866211 20:46314068-46314090 GTGTGTGTGGGGAGTGTGGTAGG - Intergenic
1175478474 20:59294034-59294056 GTTTGTCTGGGGATAGCTGCTGG - Intergenic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1178795740 21:35742609-35742631 GTTTGAATGGGGAGTGTTGTAGG - Intronic
1180258773 21:46651694-46651716 GTTCCTATGGCGATAGTTGTTGG + Intronic
1183246661 22:36699150-36699172 GTGTGTATGTGGATACAGGTAGG - Intronic
949519497 3:4836966-4836988 GTGTGGGTGGGGATAGTGATGGG - Intronic
949910499 3:8902196-8902218 ATTACTATGGGGAAAGTGGTTGG - Intronic
951326714 3:21311738-21311760 GTTTGTCTAGGGATGGAGGTGGG - Intergenic
953036619 3:39217195-39217217 ATTTGTTTGGGTAGAGTGGTGGG - Intergenic
955657261 3:61258045-61258067 TTTTGTTGGGGGAGAGTGGTAGG - Intergenic
956689248 3:71860898-71860920 GTTTATATGGGGAATGTGGCAGG - Intergenic
960455944 3:117872417-117872439 GTTTGTATATGGAAACTGGTAGG - Intergenic
961484007 3:127204926-127204948 CTTTGTATGGGGGCAGTGATGGG - Intergenic
962569529 3:136698688-136698710 GTTTGTATGGGTATCTTGCTGGG + Intronic
966631574 3:182081707-182081729 GTATGCATGGGGATAGTGGGGGG + Intergenic
969521784 4:7682265-7682287 GTTTGTATGGGGATTGAGCTGGG + Intronic
970320439 4:14870321-14870343 CTTTTTCTGGGGAGAGTGGTGGG - Intergenic
970969286 4:21962944-21962966 GATTGTAGAGGGATAATGGTGGG + Intergenic
972715434 4:41641258-41641280 GTGTGTCTGGGGATGGGGGTTGG - Intronic
972745503 4:41928279-41928301 GTGTGTGTGGGGATGGGGGTGGG + Intergenic
977962918 4:103105576-103105598 GTTTGTATAGGGATTGGGATAGG + Intergenic
978054683 4:104249087-104249109 TTGTGTATGGGTATACTGGTGGG + Intergenic
979869992 4:125806999-125807021 GTTTGGATGGGGATAGGAATGGG + Intergenic
979920134 4:126486542-126486564 ATGTGTATGGGGATAGAGGTTGG + Intergenic
985219328 4:187685915-187685937 GTGTGCATGGGGGTAGGGGTTGG + Intergenic
985383254 4:189418252-189418274 GTTTGTGTGGGATGAGTGGTCGG + Intergenic
985516061 5:345248-345270 GTGTGTGTGGGGAGAGGGGTGGG + Intronic
986343623 5:6813966-6813988 GTTTGTCTGAGCAAAGTGGTTGG + Intergenic
988296294 5:29367255-29367277 GTGTGTATGGGGGCAGTGTTCGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
992559236 5:77933829-77933851 GTGTGTGTGGTGGTAGTGGTGGG - Intergenic
992761024 5:79950959-79950981 GTCTGTTGGGGGACAGTGGTGGG - Intergenic
996111288 5:119569694-119569716 GTCTGTGTGGGGATGGGGGTGGG + Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
998327274 5:141292401-141292423 TTTTGTATGGGGATAGCAGCAGG + Intergenic
998471830 5:142389668-142389690 GTTTGTAGGGGAAGAGTGATAGG + Intergenic
1001851479 5:174970716-174970738 GTATGAATGGGAATAGTGGATGG - Intergenic
1003001808 6:2342738-2342760 GTTTGTATTGGGTGAGAGGTAGG - Intergenic
1005021302 6:21421855-21421877 GGTTGTAGGGGGATAGGGGAGGG - Intergenic
1006269404 6:32952244-32952266 TTGTGTCTGGGGATAGTGGGAGG - Intronic
1007997150 6:46320383-46320405 TTTTGTATGGTGAGAGTGATAGG - Intronic
1008321516 6:50119920-50119942 AATTGTATGGGGATAGTGATGGG + Intergenic
1009265100 6:61544544-61544566 GTTTAACTGGGGAAAGTGGTAGG + Intergenic
1009325989 6:62348228-62348250 GGTTGTTTAGGGATAATGGTAGG + Intergenic
1009684285 6:66936413-66936435 GTTGGTATGTTGATGGTGGTGGG + Intergenic
1012295818 6:97521942-97521964 GTTTGCCTGGGGCTAGTGGTGGG + Intergenic
1013921118 6:115405018-115405040 AAATGTATGGGGATAGGGGTGGG - Intergenic
1015928869 6:138336563-138336585 GTTTAAGTGGGGCTAGTGGTGGG - Exonic
1018463545 6:164021800-164021822 GTTTGTGTGGGGGGAGTGGGGGG - Intergenic
1019870422 7:3755675-3755697 GTTTGTTTGGGGTGAGGGGTTGG - Intronic
1020985494 7:15129004-15129026 GTTTGAATGCGGGTGGTGGTGGG + Intergenic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022589299 7:31645928-31645950 GTTTGTAAGGGGAAAATGTTAGG + Intronic
1023423374 7:40007929-40007951 GTTTGGATAGGTATAGTGGAGGG + Intronic
1024150643 7:46568429-46568451 GTTTGTATGGGGAGGTAGGTGGG + Intergenic
1026255474 7:68707570-68707592 GTTTGTTTGGGGACAGTCATAGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1029244190 7:99186798-99186820 GTTGGTTTCGGGATAGTGCTAGG - Intronic
1033144226 7:138857193-138857215 GTTTGTATGGAGAGAGTGAGGGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1041204652 8:55486670-55486692 ACTTGTATTTGGATAGTGGTTGG + Intronic
1042326101 8:67529535-67529557 ATTTGTCTGGGGATATTGGAGGG - Intronic
1045232754 8:100320491-100320513 ATCAGTATGGGGATAGAGGTTGG - Intronic
1046088557 8:109469395-109469417 GAATGTAGGGGGATATTGGTGGG - Intronic
1050884548 9:10747485-10747507 ATTTGTATGGGTATATTTGTGGG + Intergenic
1051492637 9:17683584-17683606 GTTTGCCTGGGTATAGGGGTAGG - Intronic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053728515 9:41028312-41028334 GTTGGTGTGGGGGTAGGGGTGGG - Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054699989 9:68403768-68403790 GTTGGTGTGGGGGTAGGGGTGGG + Intronic
1054953497 9:70881374-70881396 TTTTGTATGGGGGTGGTGGTAGG - Intronic
1055562158 9:77531778-77531800 GTGTGTTTGGGGCTGGTGGTGGG - Intronic
1055564707 9:77556725-77556747 GTGTGTCTGGGGGTGGTGGTAGG - Intronic
1055902053 9:81251529-81251551 ATTTGTATGTGGATAGTGTAAGG + Intergenic
1057360904 9:94373240-94373262 GTGTGTTTGGGGGTAGTGGGTGG + Intergenic
1058802493 9:108558238-108558260 GTTTCTATGGGGCTGGAGGTTGG - Intergenic
1059502944 9:114771068-114771090 GTTTGCAAAGGGAGAGTGGTGGG + Intergenic
1061689349 9:132313062-132313084 GTTTGACTCGGGCTAGTGGTAGG + Intronic
1061802939 9:133121951-133121973 GTCTGTAAGGGGATAGTGTGGGG - Intronic
1062626134 9:137442507-137442529 TTCTGTATGGGGATAATGCTGGG + Intergenic
1187634672 X:21213517-21213539 GTGTGTCAGGGGATAGTGGTGGG + Intergenic
1192466595 X:71361218-71361240 GTTTGTCTAGGGCTAGAGGTGGG - Intergenic
1192783982 X:74320437-74320459 CTATGTATGGGGGTGGTGGTGGG - Intergenic
1195412221 X:104579953-104579975 GTTTGTGTGGGGATAGGGGTGGG - Intronic
1200391801 X:155952914-155952936 GTTTGATTGGGGTTTGTGGTTGG + Intergenic