ID: 1157740480

View in Genome Browser
Species Human (GRCh38)
Location 18:50088416-50088438
Sequence CTTAAATACAAGTGCAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157740477_1157740480 -8 Left 1157740477 18:50088401-50088423 CCACCCTAGACACAGCTTAAATA 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1157740480 18:50088416-50088438 CTTAAATACAAGTGCAGCACTGG 0: 1
1: 0
2: 0
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157740480 Original CRISPR CTTAAATACAAGTGCAGCAC TGG Intronic
922004265 1:221513092-221513114 CTTAAATTCAAATGCAACTCTGG + Intergenic
1066669317 10:37820312-37820334 CTGAAACAGAAGTGAAGCACAGG + Intronic
1068795367 10:61073395-61073417 CTGGGATACAAGTGCAGAACAGG - Intergenic
1068968660 10:62939488-62939510 CTGAACTACATGTGAAGCACTGG + Intergenic
1070142055 10:73745496-73745518 ATTAAAACCAAGTGCAGAACAGG - Intronic
1071182579 10:83004175-83004197 CTTAAATGTAAAAGCAGCACTGG + Intergenic
1074521096 10:114224882-114224904 CTTAAATACAGGAACAGCATAGG - Intronic
1079106606 11:17576111-17576133 CTTAACAACCAGTGCAGCACAGG + Intronic
1081111484 11:39139188-39139210 CTTAGATACACTTGCAGCTCAGG + Intergenic
1081204003 11:40253574-40253596 TTTAAAGAGAAGTGCAGCACAGG - Intronic
1085416066 11:76319774-76319796 CTTAAAAACCAGTGCAGGCCAGG + Intergenic
1088030076 11:105237848-105237870 CTGAGATACACGTGCAGAACGGG + Intergenic
1096057868 12:48669898-48669920 GTTATATACAAGTCTAGCACAGG + Intronic
1097198155 12:57255916-57255938 CTTAATTACCAGTCCAGCATGGG - Intronic
1100018774 12:90044958-90044980 CTGGAATACATGTGCAGAACAGG + Intergenic
1101959058 12:109234441-109234463 CTGAAATACAATGGCATCACAGG - Intronic
1104435293 12:128751277-128751299 CATAAAAACAAATGAAGCACTGG + Intergenic
1108497377 13:51039026-51039048 CTGAAATACAGCTGCAGCCCAGG + Intergenic
1112987772 13:105472521-105472543 CTTAAATACTGTTGCAGCAAAGG + Exonic
1115112790 14:29843861-29843883 CTTAAACACAGCTGCAGGACAGG + Intronic
1115261556 14:31459786-31459808 AATAAATACAAGTGCAGGCCTGG + Intergenic
1115735389 14:36322267-36322289 CTAAGATACAAGTGCAGGTCTGG - Intergenic
1116013428 14:39378019-39378041 CTTTTATACAAGTGCATAACTGG - Intronic
1116369224 14:44108766-44108788 CTTTAACACATGTGCAGCAAGGG + Intergenic
1116577428 14:46592361-46592383 GTTAAATATAATTGCAGCTCAGG - Intergenic
1118182504 14:63507545-63507567 CTTAAAAATAACTGCAGCAAGGG + Intronic
1119878806 14:78083165-78083187 CTTAAAGACATGTTCAGCAAAGG - Intergenic
1120942977 14:89966849-89966871 CTTAAATGCAAGTTCTGTACTGG - Intronic
1124156591 15:27231157-27231179 CATACATACAAGTGCTACACTGG + Intronic
1126384238 15:48077383-48077405 CTGAAATGCTAGTGCAACACTGG - Intergenic
1129764177 15:78150479-78150501 CTTAAATAACAGTGCATCTCTGG - Intronic
1131793859 15:95993316-95993338 CTTAAATACAAATGCAGGATGGG + Intergenic
1132205058 15:99980753-99980775 ATTAAAACCAAGTGCAGCATTGG + Intronic
1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG + Intronic
1135912209 16:26571770-26571792 CTAAAATACAAGGGCAGGATAGG + Intergenic
1139370305 16:66463615-66463637 ATTAAAAACTAGTGCAGCAAAGG - Intronic
1140299406 16:73741467-73741489 CTTAAGCACACGTGCAGCATGGG - Intergenic
1140864810 16:79050608-79050630 CTCAAATACAAGTGCAGTCTTGG - Intronic
1142477395 17:197301-197323 CATATATACATGTGCAACACAGG + Intergenic
1142909588 17:3076872-3076894 CTGGGATACAAGTGCAGAACGGG + Intergenic
1142924910 17:3226943-3226965 CTGGGATACAAGTGCAGAACGGG - Intergenic
1146825370 17:36017965-36017987 TATAAATACAAGGGCAGAACTGG - Exonic
1150018895 17:61590286-61590308 CTTAAATATTAGTGCATCTCAGG - Intergenic
1152206255 17:78976243-78976265 CTGAAATACAAGCTCAGCAGGGG - Intronic
1157264678 18:46208030-46208052 CATAAATACAAGTGCAGAGAAGG - Intronic
1157740480 18:50088416-50088438 CTTAAATACAAGTGCAGCACTGG + Intronic
1159067915 18:63590202-63590224 TTTAAATACAACATCAGCACGGG - Intronic
1167717243 19:51151555-51151577 CTTAAATATCAGAGCAGCCCCGG - Intronic
925432208 2:3804754-3804776 CTTTGTTACGAGTGCAGCACGGG - Intronic
925695948 2:6578626-6578648 AATAAACACATGTGCAGCACTGG + Intergenic
933357037 2:81223882-81223904 ATTAAATACAAGTACAAGACAGG - Intergenic
934164777 2:89284081-89284103 CTTAGACACTAGTGCAGCAGAGG - Intergenic
934202497 2:89898443-89898465 CTTAGACACTAGTGCAGCAGAGG + Intergenic
936273303 2:111068956-111068978 CTGAAATACAAGTGGATCACTGG + Intronic
936328186 2:111523511-111523533 ATTAAATACATTTGCAGCACAGG + Intergenic
937041426 2:118823755-118823777 CTTCAACACATGTGCAGCCCAGG - Intergenic
938400377 2:130986459-130986481 CATTTATACAAGTGCAGCAGAGG + Intronic
938978324 2:136501094-136501116 CTTAAATGCAGGTTCAGGACTGG + Intergenic
939245705 2:139620966-139620988 CTTAACGACAAGAGCAGTACTGG - Intergenic
940599143 2:155835430-155835452 CTAAAATACAATGGCAGAACAGG - Intergenic
940604975 2:155910325-155910347 CTAAAATACAAGCACAGCAAGGG + Intergenic
942323000 2:174752273-174752295 TTTAAAAACAAGTGCAGGGCAGG + Intronic
943248133 2:185482831-185482853 GTTAAATACAGATGAAGCACTGG - Intergenic
943486565 2:188492408-188492430 CATAAATACAAGTGCAAGAATGG + Intronic
944870830 2:203910205-203910227 CTTCAATAAAAGAGCAGAACTGG - Intergenic
944956918 2:204822594-204822616 CTTAGGTACCTGTGCAGCACAGG + Intronic
948289335 2:236813718-236813740 CTGAAATCCAAGTGCAGCCCTGG + Intergenic
1170067335 20:12327362-12327384 ATTAAATACAAGTAAAACACAGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1176903381 21:14470537-14470559 CTTAACTATAAGTAAAGCACTGG - Intergenic
1184592352 22:45493533-45493555 CTTAGATAAAAGTGCAAGACGGG + Intergenic
1184908519 22:47509296-47509318 CTTAACTTCAAATACAGCACAGG + Intergenic
953500934 3:43433413-43433435 CTCAAACTGAAGTGCAGCACAGG - Intronic
957217491 3:77340145-77340167 CTATAACACAAGTGCTGCACAGG + Intronic
960358379 3:116680207-116680229 CTAAAATACAAGGGCAGGACAGG - Intronic
960608654 3:119534052-119534074 TTTAAAAACAGGTGCAGGACAGG - Intronic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
961468726 3:127097832-127097854 ATCAAGGACAAGTGCAGCACAGG + Intergenic
963292699 3:143508461-143508483 ATTTCAGACAAGTGCAGCACTGG - Intronic
967108906 3:186275538-186275560 TTTACTCACAAGTGCAGCACAGG + Exonic
967231665 3:187343240-187343262 CTTAAAAAGATGTGCAGCTCTGG + Intergenic
968206985 3:196811564-196811586 GCTAAATTCAATTGCAGCACTGG + Intronic
968783003 4:2597436-2597458 CTAAAATACAAGAGCAGGGCTGG - Intronic
969884253 4:10201226-10201248 TTTTAATATAAGTGCAGCCCAGG + Intergenic
970040371 4:11790617-11790639 CTAAATTCCAAGTTCAGCACTGG - Intergenic
971647580 4:29229255-29229277 ATTAAATAAATGTGCACCACAGG - Intergenic
974340884 4:60614022-60614044 CTTAGATACAAAGGCAGCACAGG - Intergenic
976710219 4:88062560-88062582 GTTAAATAGAAGGGCAGGACAGG + Intronic
976851851 4:89556727-89556749 CTTGAATACAAAAGCAGCCCTGG + Intergenic
977129915 4:93222944-93222966 CTTAAATACACGTTCACCAAAGG + Intronic
979947721 4:126854452-126854474 CTTAAATAAATGTGAAGCAGTGG - Intergenic
981207256 4:142057502-142057524 CTTAATTTCAAGTCCAACACTGG - Intronic
981413606 4:144462115-144462137 TTTAATAACAGGTGCAGCACAGG - Intergenic
982147976 4:152418534-152418556 CTTGAACACAAGTGTAGAACTGG + Intronic
982770163 4:159390152-159390174 TGAAAATTCAAGTGCAGCACGGG - Intergenic
984300000 4:177903677-177903699 CTTAAATAAAAGTACAGCTTGGG + Intronic
986849305 5:11792569-11792591 TTTAAATACAAGTACAGCAGGGG + Intronic
988290752 5:29282491-29282513 CTCAAATACTAGTACAGCATAGG - Intergenic
989346600 5:40437247-40437269 CTTAAATATACCTACAGCACAGG + Intergenic
990506037 5:56446456-56446478 CTGAAATACAAGCAAAGCACAGG - Intergenic
994539889 5:101080943-101080965 CTTAAAAACAAATGCAGGAAAGG + Intergenic
994651092 5:102529536-102529558 CTTAAATTCAAATGCACCTCAGG + Intergenic
995429328 5:112056744-112056766 CTTAAATGCAAGCCGAGCACAGG + Intergenic
1001287971 5:170437585-170437607 CTTGAAATCCAGTGCAGCACAGG + Intronic
1008061737 6:47004868-47004890 CAGAAATACAAGGGCAGGACTGG + Intronic
1008176746 6:48277528-48277550 CTTAAATACAGATACATCACTGG - Intergenic
1010813914 6:80332284-80332306 TGTAAATACAAGTGCAGTATAGG - Intronic
1011853614 6:91661317-91661339 CTGAAATACAAGGGCTGCAGAGG - Intergenic
1012738604 6:102982933-102982955 CTTAAATCCAAGTGAAGAAAAGG + Intergenic
1012768373 6:103397666-103397688 CTTAGATACAATGGGAGCACAGG - Intergenic
1020408909 7:7868425-7868447 CGTACATACAAGTGCAGAAGGGG - Intronic
1022021748 7:26406266-26406288 CAGAAATTCAAGGGCAGCACAGG + Intergenic
1022303334 7:29122254-29122276 CTCAACTCCAAATGCAGCACGGG + Intronic
1031448623 7:121886022-121886044 CTTAAATACAAGGGGAGTGCTGG + Intronic
1032119922 7:129148342-129148364 AGTAAACACAATTGCAGCACAGG - Intronic
1043691886 8:83164531-83164553 CTAAAATATAAGTGCTGCACAGG - Intergenic
1045891166 8:107159396-107159418 CTCAAATACATATGCAGCAGGGG - Intergenic
1048190793 8:132286481-132286503 CTAAAATACAATGGCAGAACAGG - Intronic
1052118810 9:24682733-24682755 CTGAAATAGAAGTGCAATACAGG - Intergenic
1052325170 9:27209775-27209797 TTTAAATGCATGTGCAACACAGG - Intronic
1057124390 9:92604887-92604909 CTTAAATAAAAATGCAGGCCGGG - Intronic
1059904559 9:118968038-118968060 CTTTAATACAAGTCCAGCTTGGG - Intergenic
1186328080 X:8501557-8501579 CATAAATACAAATGCAGGTCGGG - Intergenic
1186421654 X:9431766-9431788 TTTAAAAACAAGTGCAGCCTGGG + Intergenic
1187195520 X:17080018-17080040 CATAAAGATAAGTGCAGCAAAGG - Intronic
1189867436 X:45345880-45345902 CTCAAATAAAAGTGCAGCATTGG + Intergenic
1190280430 X:48925655-48925677 TTTAAATACTTGTGCAGAACAGG - Intronic
1193839516 X:86392002-86392024 CTGAGATACATGTGCAGAACGGG + Intronic
1199424066 X:147681114-147681136 CTTAAAAATAAATGCAGAACTGG + Intergenic
1201402720 Y:13620575-13620597 CTTAAATACAATGGGAGTACAGG + Intergenic
1201433938 Y:13936486-13936508 CATAAATACAAATGCAGGTCAGG + Intergenic