ID: 1157743612

View in Genome Browser
Species Human (GRCh38)
Location 18:50115416-50115438
Sequence GTGAGGAATGCAAGTTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157743612_1157743617 9 Left 1157743612 18:50115416-50115438 CCTGCAGAACTTGCATTCCTCAC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1157743617 18:50115448-50115470 TATGTACGGAGCACCTACCAGGG 0: 1
1: 0
2: 3
3: 24
4: 204
1157743612_1157743618 14 Left 1157743612 18:50115416-50115438 CCTGCAGAACTTGCATTCCTCAC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1157743618 18:50115453-50115475 ACGGAGCACCTACCAGGGCCAGG 0: 1
1: 1
2: 2
3: 23
4: 223
1157743612_1157743614 -5 Left 1157743612 18:50115416-50115438 CCTGCAGAACTTGCATTCCTCAC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1157743614 18:50115434-50115456 CTCACTTACCAAATTATGTACGG 0: 1
1: 0
2: 0
3: 7
4: 125
1157743612_1157743616 8 Left 1157743612 18:50115416-50115438 CCTGCAGAACTTGCATTCCTCAC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1157743616 18:50115447-50115469 TTATGTACGGAGCACCTACCAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1157743612_1157743621 26 Left 1157743612 18:50115416-50115438 CCTGCAGAACTTGCATTCCTCAC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1157743621 18:50115465-50115487 CCAGGGCCAGGTCTTGTGCTAGG 0: 1
1: 0
2: 3
3: 46
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157743612 Original CRISPR GTGAGGAATGCAAGTTCTGC AGG (reversed) Intronic
900521041 1:3105693-3105715 GTTAGGAATGTAATTACTGCGGG - Intronic
904371504 1:30050349-30050371 ATGAGGAAGGGCAGTTCTGCAGG + Intergenic
907418888 1:54333189-54333211 GTGGGGTATGCAAGGTCTCCAGG - Intronic
907679866 1:56553101-56553123 CTGAGGAAACCAAGTTCTTCTGG - Intronic
908943021 1:69459548-69459570 GTGAGGAGAGCAAGTCCTGAAGG - Intergenic
910333443 1:86102082-86102104 TTAAGGAATGCAATTTCTTCTGG + Intronic
911103656 1:94113412-94113434 GTTAGAAATGCAAGCTCTGGTGG - Intronic
913183170 1:116342470-116342492 GTAAGGAATGCAGGCACTGCAGG + Intergenic
915092113 1:153433827-153433849 GTGAGTGCTGCAAGTTCTTCTGG + Intergenic
916642618 1:166747100-166747122 GAGAGGAATGTGTGTTCTGCAGG - Intergenic
921280867 1:213566643-213566665 CTGAGGAATGAAAGATCTGAAGG - Intergenic
1063987623 10:11522866-11522888 GTTCAGAATGCAAGTTCTGCAGG + Intronic
1068385213 10:56317627-56317649 GTGAGGACTGCAACATCTCCTGG + Intergenic
1070238732 10:74656498-74656520 GTGAGGACTGCAGCTTTTGCTGG + Intronic
1074857909 10:117486895-117486917 GTGAGGCAAGCTGGTTCTGCAGG + Intergenic
1075185403 10:120251951-120251973 CTGAGGACTGCAGGTGCTGCGGG - Intergenic
1075544880 10:123347552-123347574 GTGAGGACTTCTAGTGCTGCAGG + Intergenic
1077307671 11:1875237-1875259 GTGAGGGAAGCCAGCTCTGCAGG + Intronic
1079326860 11:19500765-19500787 CTGAGGAATGCTAGTTCTGATGG + Intronic
1086879558 11:92137598-92137620 GTGAAGAAAGCTATTTCTGCAGG + Intergenic
1087912280 11:103767901-103767923 GTGAGGCATGGAAGTTGTGGGGG + Intergenic
1089068972 11:115684065-115684087 GTGAGGCAGGCAAGTAGTGCAGG + Intergenic
1089160449 11:116432980-116433002 GTGAGGAATGAGGGTTCTGATGG - Intergenic
1093448059 12:19282983-19283005 GTCAGGAATTCAAGATCAGCCGG + Intronic
1095878283 12:47105377-47105399 GTGCGGAAAGAAAGTTCTGAGGG + Intronic
1095881690 12:47144078-47144100 GTGAGAAATGCAAGAGCTGTGGG - Intronic
1096073206 12:48787500-48787522 GGGAGGCCGGCAAGTTCTGCGGG - Intronic
1096120820 12:49088587-49088609 GTTAGGAATGGAAGCTCTGGAGG - Intergenic
1099298417 12:80860759-80860781 GTCAGAAATGAAAGTGCTGCTGG - Intronic
1100053149 12:90475592-90475614 ATGAGGAATGCAAGGTCTTGAGG - Intergenic
1103696259 12:122818095-122818117 GGCAGGAGTTCAAGTTCTGCTGG + Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107980371 13:45729083-45729105 GTTAGGAAAGCAACCTCTGCTGG - Intergenic
1109152244 13:58859738-58859760 CTGAGAAATGCAAATTCGGCAGG - Intergenic
1116962977 14:50985977-50985999 AAGAGGAATGCAAGCTCAGCTGG + Intronic
1118603372 14:67485972-67485994 ATGAGCAATGCATGTGCTGCTGG - Intronic
1121786920 14:96668890-96668912 GGGAGGGAAGCAAGTTCTGAAGG + Intergenic
1128262018 15:66239269-66239291 GTTAGGAATGCCAGGTCTTCTGG + Intronic
1132852913 16:2032920-2032942 GTGAGGGGTGACAGTTCTGCGGG + Intronic
1134029201 16:10978281-10978303 GTGAGGAATGCTGCTTCTGGAGG + Intronic
1136615981 16:31398783-31398805 CTGAGGGATGAAAGTTCTGATGG + Intronic
1137543668 16:49382732-49382754 GTGAGGAAAGCAAGGTGTCCAGG - Intronic
1138774744 16:59707498-59707520 GTCAGCAATGGAAGTTCTGGAGG + Intergenic
1141200248 16:81892210-81892232 GGGAGGAAGGCAGGTCCTGCTGG + Intronic
1143435868 17:6924524-6924546 TTCAGGAAAGCAAGTACTGCAGG - Intronic
1143462587 17:7113820-7113842 ATGAGGAATGCAGATTCAGCTGG - Intronic
1144386826 17:14755808-14755830 TTCAGCCATGCAAGTTCTGCAGG - Intergenic
1144655177 17:17030691-17030713 AAAAGGAATGCTAGTTCTGCCGG + Intergenic
1145177165 17:20711039-20711061 GTTAGGAATGTAAGTACTGAAGG - Intergenic
1146853210 17:36241178-36241200 GTTAGGAATGTAAGTACTGAAGG + Intronic
1146869118 17:36365068-36365090 GTTAGGAATGTAAGTACTGAAGG + Intronic
1147058665 17:37855729-37855751 GTTAGGAATGTAAGTACTGAAGG - Intergenic
1147071992 17:37965699-37965721 GTTAGGAATGTAAGTACTGAAGG + Intergenic
1147083518 17:38045231-38045253 GTTAGGAATGTAAGTACTGAAGG + Intronic
1147099464 17:38169198-38169220 GTTAGGAATGTAAGTACTGAAGG + Intergenic
1148189157 17:45666796-45666818 GGGTGGATTGCAAGTTCTGGAGG - Intergenic
1149606092 17:57926179-57926201 GTGAGAAATGCCAGTTCTCCAGG + Intronic
1150082479 17:62252487-62252509 GTTAGGAATGTAAGTACTGAAGG + Intergenic
1152303100 17:79506809-79506831 GTCAGGATTCCATGTTCTGCCGG - Intronic
1153917213 18:9757014-9757036 GAGAGGAATGAATGTACTGCAGG - Intronic
1155770591 18:29693516-29693538 CTGAAGAATGCAGGTTCTCCAGG + Intergenic
1156821750 18:41381211-41381233 GTCAGAAATGCTGGTTCTGCTGG - Intergenic
1157743612 18:50115416-50115438 GTGAGGAATGCAAGTTCTGCAGG - Intronic
1159513097 18:69421884-69421906 GTGAGGAAGCCCAGTTCTCCAGG - Intronic
1164070291 19:21761830-21761852 GTGAGCAAAGCAAGATCAGCAGG - Intronic
1164623155 19:29709412-29709434 GTGAGAAAGGGAAGTACTGCTGG - Intronic
1164665968 19:30037191-30037213 GTGATTAAAGCAAGTTCTACAGG - Intergenic
1164746568 19:30620481-30620503 ATGGGGAATGGAAGTCCTGCAGG + Intronic
926131951 2:10308708-10308730 GTGAGGAACACAACTTCAGCTGG - Intronic
927289661 2:21393269-21393291 GTGAGGAAAGCAAGTCCTCTGGG + Intergenic
931450542 2:62364369-62364391 GTTAGAAATGCAAACTCTGCCGG - Intergenic
931461271 2:62452481-62452503 GTGAGGAAGGCAAATTCTCTGGG + Intergenic
931946137 2:67309852-67309874 TTGATTACTGCAAGTTCTGCTGG + Intergenic
933599622 2:84316242-84316264 CAGAGGAATGTAAGTTCTGCTGG + Intergenic
934990039 2:98914430-98914452 GTGAGGGCTGCAGGCTCTGCTGG - Intronic
935073315 2:99715059-99715081 GTGAAGGATGCAGGTCCTGCAGG - Intronic
937131737 2:119518912-119518934 GTGAGGTTGGGAAGTTCTGCGGG + Intronic
937246370 2:120496696-120496718 GTGAGGAATGTGAGGTTTGCAGG + Intergenic
937883260 2:126883873-126883895 GTGAGGAAACTGAGTTCTGCAGG + Intergenic
939959647 2:148555041-148555063 GTTAGAAATGCAAGATCTGAGGG - Intergenic
940844099 2:158621383-158621405 GTGAGGAATTCAAGAGCTGAAGG + Exonic
942037209 2:172021827-172021849 AAGAGGAGAGCAAGTTCTGCTGG + Intronic
944544462 2:200785212-200785234 GTGAGCAAGGCAATCTCTGCCGG + Intergenic
1169669125 20:8075661-8075683 GTGAATAATGGAAGTCCTGCAGG + Intergenic
1170427923 20:16253985-16254007 GTGAAGTGTGCAAGTTCTGAAGG - Intergenic
1171048584 20:21834503-21834525 TTGAAGAGTCCAAGTTCTGCAGG - Intergenic
1174845612 20:53940403-53940425 TTGTGGACTGCAACTTCTGCCGG + Intronic
1175877951 20:62239066-62239088 GTGAGGAGGGCGAGTTCCGCCGG + Intronic
1179315444 21:40240077-40240099 GTGAGAAATGCAAATTCCCCTGG - Intronic
1182017805 22:27055470-27055492 CTGAGGGATGCAAGCTCTCCTGG - Intergenic
950882777 3:16336443-16336465 GTGAGGAAGGCCAGCTGTGCTGG - Intronic
951376090 3:21919723-21919745 CTGAAGAATGCTGGTTCTGCAGG - Intronic
953351682 3:42220857-42220879 ATGAGGAAGCCAAGTTCTCCAGG - Intronic
954561388 3:51559615-51559637 GTGAGGAATGCATGTTTTCTGGG + Intronic
954790485 3:53129840-53129862 GTGAGGAACTCAGGCTCTGCAGG + Intronic
955551527 3:60090280-60090302 GAGAGGAATGACAGTTTTGCAGG - Intronic
958053944 3:88385401-88385423 ATGAGGAATGTAAGTTATGCTGG + Intergenic
960439568 3:117670083-117670105 GTGTGGAACACAAGCTCTGCTGG + Intergenic
963806926 3:149732310-149732332 GTGAGGAATGCCTCTTCTACTGG + Intronic
964513281 3:157477089-157477111 TTGAGAAATTAAAGTTCTGCAGG + Intronic
965856697 3:173097882-173097904 TTGACAAATGCAAGTTCTACTGG - Intronic
966271578 3:178113723-178113745 GAAAGGAATTCAAATTCTGCAGG - Intergenic
969010852 4:4060917-4060939 GTGACGTATGCAGGTTCTGGTGG - Intergenic
969721740 4:8895929-8895951 GGGAGGAATCCAAGCTCTGTGGG + Intergenic
969743216 4:9048974-9048996 GTGACGTATGCAGGTTCTGGTGG + Intergenic
980541688 4:134203351-134203373 CTGAGTGATGCAAATTCTGCTGG + Intergenic
981812114 4:148787918-148787940 GTGTTCAATGCAAATTCTGCTGG - Intergenic
981916191 4:150035850-150035872 GTGAGGAATTCAAGACCAGCTGG - Intergenic
984819018 4:183863318-183863340 TCAAGGAATGCAAGTTCTGGAGG + Intronic
986283415 5:6342126-6342148 GTGAGGAAAGCAAGACATGCTGG + Intergenic
989059898 5:37400142-37400164 GTTAGGAATGCAAGACCAGCTGG - Intronic
991125410 5:63064271-63064293 GTGAGGAAAGCAAGTACGGATGG - Intergenic
994893244 5:105666845-105666867 ATGAGCAATGCAATTTATGCTGG - Intergenic
994967071 5:106687039-106687061 GAGAGGAATGAAATTTCTGAGGG - Intergenic
995598383 5:113771400-113771422 GTCAGGACTGCAAGTTGTCCAGG + Intergenic
997222073 5:132177793-132177815 ATAAAGAAGGCAAGTTCTGCTGG + Intergenic
997380109 5:133429568-133429590 TTGAGGAAGGCAGGTTCTGGAGG - Intronic
997979861 5:138462338-138462360 GTGAGGACTGAAACTTATGCGGG - Intergenic
1003047658 6:2748758-2748780 GTGAGGAACTCAAGATCTGAAGG + Intronic
1008900471 6:56608915-56608937 CTGAGGAAACCAAGTTCTGTTGG + Intronic
1015294885 6:131579179-131579201 GTGAAGAATCCAAGGTCTGTGGG + Exonic
1016932106 6:149421769-149421791 GTCAGGGATGGAAGTCCTGCAGG + Intergenic
1019176056 6:170160102-170160124 GTGAGGAATAAAAGTCCTGCTGG - Intergenic
1024512546 7:50215060-50215082 CTGAGGACTGCAAGGTCTGCAGG - Intergenic
1026495991 7:70903878-70903900 TTGAGGAATGCAACTTCTCTGGG + Intergenic
1026644827 7:72158467-72158489 GTGTGGGAAGCAGGTTCTGCTGG - Intronic
1026851156 7:73724208-73724230 GTGAGGAATTCCAGTTTTACTGG + Intergenic
1028460991 7:91092339-91092361 GAGAGGAATGTAGGGTCTGCTGG + Intronic
1031665925 7:124481893-124481915 GTGCAGAATGCAAGTGCTTCAGG + Intergenic
1034467351 7:151237911-151237933 GTGAGCAATGCATGTTCTCGTGG - Exonic
1036893437 8:12611283-12611305 GTGACGTATGCAGGTTCTGGTGG - Intergenic
1037671089 8:21015968-21015990 GTGTGGGATGCAAGTCCTGTAGG + Intergenic
1037841916 8:22250875-22250897 GTGTGGACTGCAGCTTCTGCTGG + Exonic
1037884439 8:22589031-22589053 GGGAGGCATGCGGGTTCTGCCGG - Intronic
1045648566 8:104322563-104322585 TTGATGAATGCAAGTTCTTATGG + Intergenic
1058115068 9:101076119-101076141 GTGAGTAATGCAAATTCTCCAGG + Intronic
1058737573 9:107907980-107908002 TTGAGGAATGCCAGTTCTCTGGG + Intergenic
1058884238 9:109311381-109311403 CTGAGGGATGCCAGCTCTGCAGG + Intronic
1059717682 9:116929009-116929031 GTGAGGAATGCCAGAAATGCAGG - Intronic
1191738958 X:64417142-64417164 GTGAGGTATGCATCTGCTGCTGG + Intergenic
1196639923 X:118047014-118047036 GTGAGGAATGCAAATACAGCAGG + Intronic
1197934708 X:131728643-131728665 GTCAGGATTGCAAGTTGTCCAGG - Intergenic