ID: 1157745510

View in Genome Browser
Species Human (GRCh38)
Location 18:50131657-50131679
Sequence TGTAGCTCAAAAACCTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157745510 Original CRISPR TGTAGCTCAAAAACCTATGG GGG Intronic
904420762 1:30389771-30389793 TGTTGCTACAAAACCTCTGGTGG - Intergenic
915717437 1:157957596-157957618 TGTGGCTCAGAAACCTGTAGTGG - Intergenic
916084084 1:161255741-161255763 TGTAGTGCAAAAACCCAAGGAGG + Intergenic
916336172 1:163673306-163673328 AATAGCTCAGAAACTTATGGGGG + Intergenic
917676535 1:177323898-177323920 TGCAGTGCAAAAACCTAAGGAGG + Intergenic
1064441467 10:15357527-15357549 TGCAGCTCAAAACCCTATCAAGG - Intronic
1065795162 10:29300271-29300293 TATAGCTAACAAACCAATGGAGG - Intronic
1065947690 10:30622119-30622141 TATAGCTAACAAACCAATGGAGG + Intronic
1068859170 10:61829545-61829567 TGCAATTCAAAAACCTATGGTGG + Intergenic
1068927099 10:62551785-62551807 AGGACCTCAAAAACTTATGGAGG - Intronic
1069323928 10:67207503-67207525 TGTAGCTTAAGAACCTCTGTGGG + Intronic
1080022312 11:27575558-27575580 TGTGGCTGAAAAAGCTATTGAGG - Intergenic
1082730868 11:56795877-56795899 TGTTCCACAATAACCTATGGGGG + Intergenic
1082855970 11:57806910-57806932 TGTAGGGAAAAAACCTATAGAGG + Exonic
1084685818 11:70694616-70694638 TGTAGCTCACAAACCCTTGTTGG - Intronic
1086192090 11:84091954-84091976 TGTTGTTAAAGAACCTATGGGGG - Intronic
1088860620 11:113795799-113795821 TGGAACTCATAAACCGATGGTGG + Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1095326483 12:40900408-40900430 TGTAGGACAAAAATCTATGTGGG - Intronic
1095932585 12:47642833-47642855 TGTACTCCAATAACCTATGGGGG + Intergenic
1097466079 12:59926245-59926267 TGTTTCCCAATAACCTATGGGGG + Intergenic
1098611206 12:72460454-72460476 TGGAGCTTAAAAACCAATGGGGG - Intronic
1107104618 13:36630074-36630096 TGAAGCTAAAAAGCCAATGGAGG + Intergenic
1107272812 13:38640657-38640679 TGTAGCTCATAAAACGAGGGTGG - Intergenic
1107446705 13:40475790-40475812 GGTAGCTCAGAAACCACTGGAGG - Intergenic
1109451122 13:62515631-62515653 TATAGTCCAGAAACCTATGGTGG + Intergenic
1117582425 14:57165727-57165749 TGTATTTCAAAAAATTATGGTGG - Intergenic
1119589788 14:75875240-75875262 TTTAACTCAAAAATCTATTGTGG + Intronic
1121471585 14:94159291-94159313 TGTACCCCCATAACCTATGGGGG - Intronic
1135985195 16:27178890-27178912 TGTGGCTCCAAAACCCTTGGTGG + Intergenic
1137515544 16:49140373-49140395 AGTTCCTCTAAAACCTATGGTGG - Intergenic
1145088509 17:19965436-19965458 TCTTGCTCAAAAACCTACAGTGG + Intronic
1146617019 17:34364807-34364829 TTTAGCTCAAAAACCTGCAGTGG + Intergenic
1146747240 17:35342926-35342948 AGTAGCTATTAAACCTATGGTGG - Intergenic
1147351597 17:39851519-39851541 TGGATCTCAAAAATCTATTGAGG + Intronic
1148172469 17:45534191-45534213 TGTGGCTCACGAACCTATGTAGG - Intergenic
1148276800 17:46311262-46311284 TGTGGCTCACGAACCTATGTAGG + Intronic
1148285298 17:46384611-46384633 TGTAGGTCAAAAATCCATAGCGG - Intergenic
1148298917 17:46528846-46528868 TGTGGCTCACGAACCTATGTAGG + Intronic
1148307462 17:46602207-46602229 TGTAGGTCAAAAATCCATAGCGG - Intronic
1148363452 17:47033368-47033390 TGTGGCTCACGAACCTATGTAGG + Intronic
1150305835 17:64084665-64084687 TGTGACTCAAAATCCTTTGGTGG + Intronic
1151138769 17:71972087-71972109 ACTCCCTCAAAAACCTATGGGGG + Intergenic
1155703547 18:28779298-28779320 TGTTGCTCAAAAACCCTTGGGGG - Intergenic
1155797587 18:30059610-30059632 TACAGCTCATAAACATATGGGGG - Intergenic
1157745510 18:50131657-50131679 TGTAGCTCAAAAACCTATGGGGG + Intronic
1157755473 18:50213575-50213597 GGTGGCACAAAAACCTAAGGAGG + Intergenic
1159568254 18:70081301-70081323 TGTTCCCCAATAACCTATGGGGG + Intronic
1159772664 18:72565444-72565466 TGTAGCTAAAAAACTTGTTGAGG + Intronic
1160392711 18:78547255-78547277 TGTCGCTCAAAACCCTCTGCCGG - Intergenic
1168481141 19:56720694-56720716 TGTAGTTTAAAAACTTCTGGTGG + Intergenic
941697925 2:168573173-168573195 TGTACCCCAGTAACCTATGGGGG + Intronic
944291703 2:198014915-198014937 TGAGGCTCAAAAATATATGGGGG - Intronic
945085988 2:206133075-206133097 GGAAGCTAAAAAACCAATGGTGG - Exonic
1169368800 20:5012518-5012540 TATGGCTCAAAAACCAATTGTGG - Intergenic
1174721866 20:52821379-52821401 TGGAGCTCAGAAACCCATAGTGG - Intergenic
1178218998 21:30633992-30634014 TGTAGCTAAAAAGTTTATGGGGG + Intergenic
1178440686 21:32595680-32595702 TGGAGCTCAGAAACCTGTGCTGG + Intronic
1178539180 21:33434963-33434985 TGTAACTCAGAGACCTTTGGCGG - Intronic
1180966373 22:19789884-19789906 CATAGCTAAAAAACCTTTGGTGG + Intronic
1182089532 22:27584627-27584649 TTTAGCTCAAACACATAAGGAGG - Intergenic
950244513 3:11404013-11404035 TGTAGGTCAAAAATCTGGGGGGG - Intronic
950409744 3:12827753-12827775 TGTGTCTCAAACACCTTTGGTGG + Intronic
955039948 3:55306544-55306566 TGTAGCTGAAATACCCATAGTGG + Intergenic
956239052 3:67108555-67108577 TGTACCCCAATAACTTATGGGGG - Intergenic
959314100 3:104780039-104780061 TATAGCTTAAAAACCCATTGAGG - Intergenic
959753597 3:109868905-109868927 TATAGCTCAAAGACATATGTAGG + Intergenic
960944837 3:122958743-122958765 TTTAGCTCTAAAATCTATGGGGG + Intronic
962155465 3:132943983-132944005 TGTGGCTCTGTAACCTATGGAGG - Intergenic
966050131 3:175605912-175605934 TGTAGCTCAGTATCCTTTGGTGG + Intronic
970181636 4:13403367-13403389 TCTGGCTCAAAAACCTTTAGTGG + Intronic
970846923 4:20551454-20551476 TGTACTTCCAAAAACTATGGAGG - Intronic
971661869 4:29428678-29428700 TCAAGCACAAAAAGCTATGGAGG - Intergenic
974187744 4:58463426-58463448 TGCAGCGCAAAAACCCAAGGAGG + Intergenic
984498062 4:180523524-180523546 TCTAGCTCAAAAACCTGCAGTGG + Intergenic
985972462 5:3389257-3389279 TGTAGCTCAAAGACATTTGGGGG + Intergenic
988504566 5:31810566-31810588 TGAAGTTCAAAAATCTCTGGAGG - Intronic
990379935 5:55213036-55213058 TGTAGGTCAGAAGCCTATGTTGG - Intergenic
991028545 5:62057903-62057925 TGCAGCTAAAAATCCTATGAAGG - Intergenic
995020773 5:107365057-107365079 TATAGATCAAACACCTATGATGG - Intergenic
999737509 5:154523722-154523744 AGTTTCTCAAAAACCTCTGGAGG - Intergenic
1006009691 6:31032092-31032114 TGAATCTAACAAACCTATGGTGG - Intronic
1009481839 6:64169081-64169103 TGGAGCTCACAAATCTAAGGAGG - Intronic
1012544740 6:100405588-100405610 TTTAGCTCAAAAACATATTCTGG + Intronic
1012767317 6:103385085-103385107 TGAAGCTCAAAAACATAATGTGG + Intergenic
1013660511 6:112291596-112291618 TGTAGCCCAAAAGCTTAGGGAGG - Intergenic
1016756968 6:147697877-147697899 TTTAGCTAAAAAAACTATGTAGG + Intronic
1017830115 6:158119061-158119083 TGTAATTGAAAAACCTATGGAGG - Exonic
1020691826 7:11364852-11364874 TGTACATCAAAGACCTCTGGGGG - Intergenic
1021451618 7:20787349-20787371 TGTAACTGACAAACCTAGGGAGG + Intergenic
1022657583 7:32334446-32334468 TGTACCCCAATAACCTATGGGGG - Intergenic
1025006215 7:55357012-55357034 CATAGCTAAAAAGCCTATGGGGG + Intergenic
1026421178 7:70239141-70239163 TGTAGTTCATAAAATTATGGAGG - Intronic
1028094549 7:86744294-86744316 TGTATCCCAAAAACTTATGAGGG - Intronic
1030459506 7:109813915-109813937 TGTAGATATAAAACCTCTGGAGG - Intergenic
1030695240 7:112577915-112577937 TGTAGCTGGAAAAACTATGGGGG + Intergenic
1033178454 7:139149553-139149575 TGTTGCACACAAAGCTATGGTGG - Intronic
1034000818 7:147410826-147410848 TGTAGCTTAAAATCTTATGGAGG - Intronic
1036757750 8:11482544-11482566 AGTAGTTCAGAAACCTCTGGAGG + Intergenic
1039010637 8:33089359-33089381 AGTGGCTCAAACATCTATGGCGG - Intergenic
1040698000 8:50025599-50025621 TGTAGTTGGAAAACCTATGTCGG + Intronic
1042719146 8:71808121-71808143 TGCTGCTCAAAGACCCATGGTGG + Intergenic
1045203426 8:100011071-100011093 GGGAGCTTTAAAACCTATGGAGG + Intronic
1045570594 8:103365338-103365360 TGTAGTTAATAAACCTATAGTGG + Intergenic
1052415770 9:28175233-28175255 TGAACCTCAACAACCTCTGGAGG + Intronic
1054738732 9:68782786-68782808 TGAAGTTCAAATACCTCTGGAGG - Exonic
1057102663 9:92377759-92377781 TGTAGTTCAATATCCTATTGTGG + Intronic
1057414909 9:94852606-94852628 TGTGGCTCAAAGACCACTGGGGG + Intronic
1058012756 9:99996542-99996564 TGTACCCCAATAACCAATGGGGG - Intronic
1058215609 9:102229917-102229939 TGTAGCTTAAAAACTTAGTGAGG - Intergenic
1059588410 9:115631071-115631093 TGTAGCTCAAAGAAACATGGTGG - Intergenic
1061461449 9:130742660-130742682 AGTAGCTCAAAACTCTCTGGTGG + Intronic
1194149028 X:90300091-90300113 TATTGCTCTAAAACCTATGAGGG + Intergenic
1194835791 X:98681387-98681409 AGTAGCTCTAAAGCCTATGGTGG - Intergenic
1195850763 X:109279611-109279633 TGTAGTGCAAAAACCCAAGGAGG - Intergenic
1199862991 X:151818802-151818824 TGGAGCTCAAAATCCAAAGGTGG - Intergenic
1201361506 Y:13155957-13155979 TTTAACTCCAAAACCTATGTAGG + Intergenic