ID: 1157749755

View in Genome Browser
Species Human (GRCh38)
Location 18:50167845-50167867
Sequence CCGTGGGGCCAGAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 389}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157749755 Original CRISPR CCGTGGGGCCAGAGGGCAGA TGG (reversed) Intronic
900154413 1:1198250-1198272 CCGTGGGGTCACAGGGCGGCAGG - Intergenic
900582432 1:3415721-3415743 CCGTGGGGGCAGCGGGCAGGAGG - Intronic
900689202 1:3969685-3969707 TCTTGCAGCCAGAGGGCAGATGG - Intergenic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
901270064 1:7945395-7945417 GTGTGGGTCCAGAGAGCAGATGG - Intergenic
902096068 1:13947044-13947066 CCATGGGGGCAGAGATCAGAGGG - Intergenic
902434742 1:16391175-16391197 CCATGGGGCTAGAAGGGAGATGG + Intronic
902663312 1:17920437-17920459 CAGTGGAGCCATAGGGTAGAAGG + Intergenic
903166689 1:21525218-21525240 CCGTTTGGCCAGAGGCCAGCTGG - Intronic
903339882 1:22647249-22647271 CCGAGGACCCAAAGGGCAGAAGG + Exonic
903501249 1:23801057-23801079 CCGAGGGGGCAGGGGGCAGAGGG + Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904604562 1:31691597-31691619 CATTGGGCCCAAAGGGCAGAAGG - Exonic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
906065407 1:42977009-42977031 CACTGGGGCCAGATTGCAGAGGG + Intergenic
907071003 1:51534826-51534848 CCCTGGGTCCAGAGGAGAGAAGG - Intergenic
907276115 1:53317413-53317435 CCCTGGGGCCCCAGCGCAGATGG + Intronic
907330054 1:53664891-53664913 CCCTGGGGCAAGAGCACAGATGG + Intronic
907495597 1:54842136-54842158 CATGGGGGCCAGAGAGCAGATGG + Exonic
907527654 1:55063261-55063283 CTGTGAGGCCAAAGTGCAGACGG - Intronic
915012249 1:152698406-152698428 CCTGGGAGCCAGAGGGCACAGGG + Intronic
915339329 1:155167619-155167641 CCGTGGGAGCACTGGGCAGAGGG - Intergenic
915364184 1:155304960-155304982 CTGTGGGGCCAGGAGGCTGACGG + Intergenic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
917802347 1:178581997-178582019 TCAAGGGGCCAGAGAGCAGATGG - Intergenic
918215974 1:182392032-182392054 CCGGGAGGGCTGAGGGCAGAGGG + Exonic
918445811 1:184615701-184615723 CAGTAGGGCCAGTGTGCAGATGG + Intronic
920180465 1:204129265-204129287 GCGGAGGGCCGGAGGGCAGAGGG - Intergenic
921325369 1:213982936-213982958 CCGCGGGGCCAGAGCGAGGAGGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921670131 1:217916019-217916041 CCATGGGGCCAGATGGCATGGGG - Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922098220 1:222460620-222460642 CTGTAGGGCCAGAAGACAGATGG + Intergenic
922107012 1:222521318-222521340 CCGTGAGGCTAGAGGCAAGAGGG - Intergenic
922227632 1:223659371-223659393 CAGTGGGGCCAGATCACAGAGGG - Intronic
922777028 1:228219553-228219575 CTGTGAGGCCAGGGGACAGAGGG + Exonic
922800869 1:228364257-228364279 CCGCAGGGCCAGGGGGCATAGGG + Intronic
922822739 1:228495120-228495142 CCTTGGGGCCTGGGGGGAGATGG + Exonic
922873168 1:228919227-228919249 ACGGTGGGCCAGAAGGCAGAAGG - Intergenic
923087831 1:230714504-230714526 CCGGAGGTGCAGAGGGCAGAGGG + Intergenic
923549955 1:234955598-234955620 CCCTGGGGGCAGGGGGCAGAGGG + Intergenic
1062903472 10:1163189-1163211 CCGTGGGTCCAGAGGGCAAGAGG - Intergenic
1064230002 10:13521549-13521571 CAGTGGGGCCAGGGTGCTGAAGG + Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1066069480 10:31792220-31792242 CACTGGGGCCTGAGGGTAGAGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1069642027 10:69962351-69962373 CTGTGGGGCCAGAGGGCCTCAGG - Intronic
1069680748 10:70283730-70283752 CCTTCGGGCCAGCGGGCAGAGGG + Intergenic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1070780708 10:79135985-79136007 CCGCTGGGGCTGAGGGCAGATGG + Intronic
1071363461 10:84875317-84875339 CAGTGGGGCCAGAAAGCAGTGGG - Intergenic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076402476 10:130193091-130193113 CCATGGGGACTGTGGGCAGATGG - Intergenic
1076615437 10:131751526-131751548 CCGGGAGGCCAGAGGTCAGGTGG - Intergenic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1077219046 11:1407327-1407349 CGGTGTTGCCAGAGGGCATAGGG - Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077409549 11:2397113-2397135 CCCTGGGACCCCAGGGCAGAAGG - Exonic
1077867503 11:6234958-6234980 AGGTGGAACCAGAGGGCAGAAGG + Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078645595 11:13139071-13139093 CTGTTGGGGCAGGGGGCAGAGGG - Intergenic
1079203748 11:18396138-18396160 GCATCGGGCCAGAAGGCAGAAGG - Intronic
1079748517 11:24164079-24164101 GAGTGGGGCCAGATTGCAGAGGG - Intergenic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1081853044 11:46287008-46287030 CAGTGGGTCCACAGGTCAGATGG + Intronic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1083733867 11:64668682-64668704 AGGAGGGGCCAGAGGGCAGCAGG + Intronic
1084043705 11:66557110-66557132 CTGTGGGGGGAGTGGGCAGAAGG - Intronic
1084197188 11:67530135-67530157 CCATGGAGCCAGAGGGCTGTGGG + Intergenic
1084518622 11:69649696-69649718 CTGTGGGGCCAGAGGAATGAAGG + Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1085297457 11:75439122-75439144 CCGTGGGAACAGGGAGCAGAGGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085412092 11:76297397-76297419 CCATGGGGCCAGCGGGCACTGGG - Intergenic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1088357837 11:108961709-108961731 CCGTGGGCACACAGGGCAGAAGG + Intergenic
1088827327 11:113506925-113506947 CCTTGGGGAATGAGGGCAGAAGG + Intergenic
1088970605 11:114771667-114771689 CCTTGGGGCCATAGTGGAGAAGG - Intergenic
1089381599 11:118036675-118036697 CCATGGGGGCAGAGGGTAGCAGG + Intergenic
1089462425 11:118660999-118661021 CTGTGGGGCCCAAGGGCAGCTGG - Intronic
1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG + Intronic
1089800706 11:121024462-121024484 CCCTGGGGCTAGAGGGAGGATGG + Intronic
1090208672 11:124899936-124899958 CTGTGGGGCCAGAGTGATGAAGG + Intergenic
1090377166 11:126298948-126298970 CCGTTGTTCCAGAGGGAAGAAGG - Intronic
1090404295 11:126467781-126467803 CCTTGAGGCCAGAGGCCAGAGGG + Intronic
1090752401 11:129759105-129759127 GCAAGGGGCCAGTGGGCAGACGG + Intergenic
1091020575 11:132096019-132096041 TCATGGGGCCTGGGGGCAGAGGG - Intronic
1091315886 11:134613802-134613824 CTGTGGGGCCAGAGAGCACTGGG + Intergenic
1091450631 12:570201-570223 CCGAGGGGACGGCGGGCAGAAGG + Intronic
1091703928 12:2681079-2681101 TCATGAGGCCAGAGGGGAGAAGG - Intronic
1091710607 12:2737555-2737577 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091713453 12:2759617-2759639 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1092256464 12:6928655-6928677 CTGTGGGGCCAGAGGGTATCCGG + Intronic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1096622993 12:52876011-52876033 TCTTAGGCCCAGAGGGCAGAGGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101012731 12:100467670-100467692 CAGTGGGGACAGAGGCCAGTTGG + Intergenic
1101604560 12:106238321-106238343 CAGTGGGGACAGAGGGCACCGGG + Exonic
1102025271 12:109711133-109711155 CTGAGGGGGCAGGGGGCAGAGGG - Intergenic
1102641279 12:114368929-114368951 CCCTGGGGCCAGGAGGCTGAAGG + Intronic
1103444161 12:120983109-120983131 CCCAGGGGCCAGAGGGCAAGAGG + Intronic
1104081483 12:125434185-125434207 CCGTGGCTGCAGAGGTCAGAGGG - Intronic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1104864481 12:131944732-131944754 GGGTTGGGGCAGAGGGCAGAAGG + Exonic
1104877284 12:132044328-132044350 CAGGGGGGCAAGAGGGCAGGAGG - Intronic
1104964769 12:132503959-132503981 CCATGGGGGCAGGGGGCTGAGGG - Intronic
1105280994 13:18962520-18962542 CTGCGGAGCCTGAGGGCAGACGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1106232283 13:27830061-27830083 CCGTGGGGCCTGCGGGCTGCGGG - Intergenic
1107126889 13:36856035-36856057 TGGTGGTGCCAGGGGGCAGAAGG + Intronic
1112294733 13:98176910-98176932 CTGTGGGGCCAGAGGACATGGGG - Exonic
1113614217 13:111669604-111669626 CCGAGGGGGCAGGGGGCAGGGGG - Intronic
1113619685 13:111754518-111754540 CCGAGGGGGCAGGGGGCAGGGGG - Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1114532291 14:23403512-23403534 CCATGGGGGCAGAGGGCAGGGGG + Intronic
1116041073 14:39686973-39686995 ACTTGGGGCTAAAGGGCAGACGG - Intergenic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117737009 14:58777728-58777750 CCATGGGGTCAGAGGGCAAGGGG + Intergenic
1118796940 14:69152665-69152687 GGGTGGGGACAGAGGGCAGGAGG + Intronic
1119543784 14:75457405-75457427 CTGTGGGGCATGAAGGCAGAGGG + Intronic
1120930646 14:89844824-89844846 TCATGGGGCCTGAGGCCAGAGGG - Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121304362 14:92896865-92896887 CCTGGGGGCCAGGAGGCAGAAGG + Intergenic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122152374 14:99731994-99732016 TCTCAGGGCCAGAGGGCAGAGGG + Intergenic
1122221009 14:100239146-100239168 CCGTGGGGAAGGAAGGCAGAGGG - Exonic
1122696787 14:103558167-103558189 CGGTGGGGTCAGAGGGCAGTCGG - Intronic
1123662218 15:22574412-22574434 CGGTGTAGCCAGAGGACAGAGGG + Intergenic
1124262000 15:28201095-28201117 CGGTGTAGCCAGAGGACAGAGGG - Intronic
1124316020 15:28668694-28668716 CGGTGTAGCCAGAGGACAGAGGG + Intergenic
1125325010 15:38527446-38527468 CCTTGGGGCCAGGGGGCCAAAGG - Intronic
1125757321 15:42072391-42072413 ACCTGGGGCCAGAGGGCATCAGG + Exonic
1127309123 15:57736833-57736855 CCATCGGGCCAGAATGCAGAAGG - Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1127838901 15:62812797-62812819 CCGAGGGGCGGGCGGGCAGATGG + Intronic
1128145689 15:65331299-65331321 CCGGGGGGACAGCGGGGAGAAGG + Intronic
1128609922 15:69065268-69065290 CTTTAGGGGCAGAGGGCAGAAGG + Intergenic
1128939554 15:71777332-71777354 CCGTGTGGCCAACAGGCAGACGG + Exonic
1129191751 15:73941647-73941669 CCCTGAGGCCAGAGAGGAGACGG + Intronic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129608184 15:77034975-77034997 CCGTGGGCCCACAGGGAGGAGGG + Intronic
1129773602 15:78218483-78218505 CAGTGGGGACACAGAGCAGAAGG + Intronic
1130096590 15:80860801-80860823 TGGTGAGGTCAGAGGGCAGAGGG - Intronic
1132202120 15:99962239-99962261 CCGGTGGGGAAGAGGGCAGAAGG + Intergenic
1132464220 16:70342-70364 ACGTCTGGCCAGAGGACAGATGG + Intronic
1132756668 16:1488520-1488542 AGGTGGGGCCAGAGGCTAGAAGG - Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132847374 16:2006721-2006743 ACGTGGGGGCAGGGGGGAGATGG + Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133026356 16:2990531-2990553 CCCTGGGGCGAGAAGGCAGGAGG - Intergenic
1133201975 16:4209315-4209337 GCCTGGGGGCAGGGGGCAGAGGG - Intronic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1134046170 16:11102899-11102921 CCTGAGGGCCAGAGGGGAGACGG + Intronic
1134073176 16:11273151-11273173 ACGTGGGGCCAGAAGGGATAGGG + Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1137677254 16:50309812-50309834 CCCTTGGGCCAGAGGCCAGCTGG - Intronic
1137719770 16:50621290-50621312 GTGTCAGGCCAGAGGGCAGATGG - Intronic
1138350716 16:56344979-56345001 CCCTGGGGACAGAGGACAGCAGG + Exonic
1138510177 16:57504096-57504118 CCCTTGGGACTGAGGGCAGAGGG + Intergenic
1139348695 16:66321835-66321857 CCCTGGGACCAGAGGCCATATGG - Intergenic
1139357769 16:66377456-66377478 CAGTGGGCCCAGAGGTCAGCTGG + Intronic
1139372302 16:66476650-66476672 TGGTTGGGCCAGAGGGCAGCTGG - Intronic
1139377433 16:66508982-66509004 ACGTGGGGGCAGAGGGGAGAGGG + Exonic
1139504568 16:67392532-67392554 GGGTGTGGCCAGAGGGCTGAGGG - Intronic
1140477661 16:75247086-75247108 AGGTGGGGGCAGAGGGGAGAAGG - Intronic
1140866345 16:79065820-79065842 CCGTGGGGCTAGAAGCAAGATGG + Intronic
1141452920 16:84117401-84117423 CCGTGGGGCCGGGGGTCAGGAGG - Intergenic
1141592852 16:85080096-85080118 CCCAGAGGGCAGAGGGCAGAGGG + Intronic
1141700729 16:85640898-85640920 CCCGGGGGCCAGAGGGCTGGTGG + Intronic
1141829352 16:86501080-86501102 CCCAGGGGCCACAGAGCAGATGG + Intergenic
1141838978 16:86562162-86562184 AGGTGGGGTCAGAGGGGAGAAGG - Intergenic
1142124541 16:88403632-88403654 CTGTGGGGGCCGAGGGCAGGAGG - Intergenic
1142142672 16:88479542-88479564 CGGTGGGGACAGAGAGGAGACGG - Intronic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1142709570 17:1715864-1715886 CCGAGGGGCCGGAGGGCCGGGGG - Intergenic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1143622897 17:8091200-8091222 CCCTGGGGACACAGGGCAAAGGG - Intergenic
1144201624 17:12947356-12947378 CCCTGTGGTCAGAGGCCAGAGGG - Intronic
1144650697 17:17005104-17005126 CCCTGGGACCTGAGGGCTGAGGG - Intergenic
1145006622 17:19342191-19342213 CAGTAAGGCCAGAAGGCAGAGGG + Intronic
1145791760 17:27632000-27632022 GCGTGGGGTCAGAGGGCGGCAGG + Intronic
1145827540 17:27888373-27888395 TGGTGGGGCCTGAGGGCAGGTGG - Intronic
1146705332 17:34997041-34997063 CCCTGGGGGCATAAGGCAGATGG + Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147169237 17:38608538-38608560 AAGTGGAGCCAGAGGACAGATGG + Intergenic
1147370901 17:39992361-39992383 GTGTGAGGGCAGAGGGCAGAGGG - Intronic
1148475624 17:47926878-47926900 TCCTGGGGCTAGAGGGCTGAGGG + Intronic
1148761403 17:50003594-50003616 CGGTGAGGCAAGAGGGTAGATGG + Intergenic
1148764077 17:50027385-50027407 CCGCGGAGCCAGCGGGCAGTGGG + Intergenic
1148769325 17:50057704-50057726 CAGTGGGGTCAGAGGCCAGGTGG - Intronic
1148772744 17:50076522-50076544 CGGTGGGGCGAGAGGGCACTGGG + Intronic
1148891937 17:50814224-50814246 TGCTGGAGCCAGAGGGCAGAGGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151572223 17:74932562-74932584 AGGTGGGGCCAGAGGGCAGGGGG - Intronic
1151932098 17:77238936-77238958 CTCTGGGGCCAGATGGCAAAGGG + Intergenic
1152339429 17:79716095-79716117 CCCTGGGGGTACAGGGCAGAGGG + Intergenic
1152622448 17:81372160-81372182 CCATGGGCCCAGAAGGCACAGGG + Intergenic
1152691354 17:81719566-81719588 CCCGGGGTCCAGTGGGCAGAGGG - Intronic
1152699663 17:81812705-81812727 CCTCAGGGCCAGAGGGCAGCTGG + Intronic
1152700959 17:81819594-81819616 CCGTGGGGCCCGATCCCAGAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1160383642 18:78479720-78479742 CCGAGGGCACAGTGGGCAGAGGG - Intergenic
1160538371 18:79607315-79607337 CCATGGGGCCAGAGGGACGGAGG + Intergenic
1161008257 19:1947384-1947406 TCCTGGGGACAGAGGTCAGATGG - Intronic
1161063715 19:2227554-2227576 GCGGGGGGCCGGAGGGCGGAGGG + Intronic
1161109480 19:2461442-2461464 AGGCGGGGCCAGAGGGGAGAAGG + Intergenic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161421959 19:4180910-4180932 CTGTGGGGGGAGAGAGCAGACGG + Intronic
1163303722 19:16463973-16463995 CCAGGGGGCCACAGAGCAGAGGG + Intronic
1164536172 19:29087898-29087920 CTGTGGGGCCAGGGGGAACAAGG + Intergenic
1164729885 19:30495601-30495623 GCGTAGGCCCACAGGGCAGAAGG + Intronic
1164995829 19:32720048-32720070 TCCTGGCGCCCGAGGGCAGATGG - Intronic
1165449661 19:35874672-35874694 CCGTGGGGGCAGAGAGCAGAGGG + Intronic
1165717862 19:38058227-38058249 CCGAGGGACCAGCTGGCAGATGG - Intronic
1166081057 19:40444330-40444352 CTGGTGGGCCAGAGGCCAGACGG - Exonic
1166356464 19:42230313-42230335 CCTTGGGGGCAGAGGACAGGAGG + Exonic
1166915241 19:46190972-46190994 CTGAGGGGCCTGAGGGGAGATGG - Intergenic
1166985718 19:46659276-46659298 CCGGGAGGACAGAGGGCTGAGGG + Intronic
1167322283 19:48804663-48804685 CCGCGGGTCCAGGGGGCGGAAGG - Intronic
1167618387 19:50548517-50548539 ATGCGGGGCCAGCGGGCAGAGGG - Intronic
1167634966 19:50649100-50649122 ACGTGGGGACAGAGGGGAGGAGG + Intronic
1168241573 19:55091620-55091642 CTGTGGGGGCTGTGGGCAGAGGG - Intronic
1168346631 19:55653034-55653056 CCGCGGGGCCAGGGCGGAGACGG - Exonic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
925457067 2:4024788-4024810 GCATGGGGGCAGAGGGCAGTGGG - Intergenic
927104694 2:19813034-19813056 CCTTGTGGCCAGAGGCCTGATGG - Intergenic
927277725 2:21275736-21275758 CCCTGGGGCCAGTGCCCAGAGGG + Intergenic
927853078 2:26511987-26512009 TGCTGGGGCCAGAGGGCAGTGGG - Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929593678 2:43162506-43162528 CCTTGGGGGCAGTGGCCAGAGGG + Intergenic
929779170 2:44946800-44946822 CCTTGGGGCCAGTGGGAACATGG - Intergenic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
931434776 2:62236704-62236726 CAGTGGGGTCAAAGGGCAAAAGG - Intergenic
931441144 2:62291508-62291530 TCATGTGGCCAGAGGTCAGAAGG + Intergenic
932103609 2:68923524-68923546 CGGTGGGGCCAGATGGGACAGGG - Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932594891 2:73087688-73087710 CCTTGAGGCCAGAGGGCAAGAGG + Intronic
933834976 2:86238690-86238712 CTGTGGGTGCACAGGGCAGAAGG + Intronic
935075949 2:99744040-99744062 GGGTGGGGGCAGAGGGCAGAAGG - Intronic
935259016 2:101338624-101338646 CTGTGGGGCCAGAGCCCAAAAGG + Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935796606 2:106647846-106647868 CTGTGAGGCCACAGGCCAGAGGG + Intergenic
937044332 2:118843287-118843309 GGGTGGGGACCGAGGGCAGAAGG + Intronic
937955096 2:127417670-127417692 CCGGGGTGCCAGAAGGGAGAAGG - Intergenic
937985715 2:127637266-127637288 CTGTGGGTGCAGAGGGCAGGTGG - Intronic
937992947 2:127674435-127674457 ACGAGGGGCCTGAGAGCAGAGGG + Intronic
939994324 2:148906125-148906147 CCTTGGGGCCAGAGGGAAAAAGG + Intronic
940223753 2:151381131-151381153 ACTTGGGGCAAGAGGGAAGATGG - Intergenic
942292495 2:174486742-174486764 CCGCGGGGCCAGGGCGCAGAGGG + Intronic
943528083 2:189043195-189043217 CCGAGGTGACAGAGGTCAGAAGG - Exonic
944203794 2:197136068-197136090 AGGTTGGGCCAGATGGCAGAGGG - Intronic
946033425 2:216723298-216723320 GAGTGGGGTTAGAGGGCAGAAGG - Intergenic
947729551 2:232420440-232420462 CCGTCGGGCCACCGAGCAGAAGG - Intergenic
947741573 2:232487281-232487303 CCGTCGGGCCACCGAGCAGAAGG - Intronic
948596329 2:239082026-239082048 CTGTGGGGGCACGGGGCAGACGG - Intronic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
948814361 2:240502357-240502379 ATGTTGGGCCAGAGGGGAGAAGG - Intronic
948883456 2:240871680-240871702 CCCTGGGGACAGAGGTCAGTGGG - Intronic
949040963 2:241849839-241849861 CTGTGGGGGCAGTGGGCAGGAGG - Intergenic
949042848 2:241857516-241857538 CGGGGGAACCAGAGGGCAGAGGG - Intronic
1168924484 20:1567904-1567926 TCTTGGAGCCACAGGGCAGAAGG + Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1171248501 20:23632122-23632144 CCATGGGGCCACCGGGCGGAGGG + Intronic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172183388 20:33016979-33017001 CCCTGGGGCTGGAGGGCACAAGG - Intronic
1174020826 20:47526771-47526793 CCATGGGGAGAGAGGGGAGAGGG + Intronic
1174343440 20:49912527-49912549 CCCTGGGGCCAGAGGCGTGATGG - Intronic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175869851 20:62203703-62203725 CCCTGGGGACAGAAGGTAGACGG - Intergenic
1176040657 20:63064229-63064251 CCGTGGGCTCTGAGGGCCGAAGG + Intergenic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179585918 21:42374054-42374076 GCGTGGGCACAGAGGGCAAAGGG - Intronic
1179643433 21:42761399-42761421 TCGTGGGGCCAGGGATCAGAAGG + Intronic
1180180012 21:46114034-46114056 CCTTGGGGCCAGAGGGCCCAGGG - Exonic
1180959022 22:19754390-19754412 CCCTGGGACCAGGGAGCAGATGG + Intergenic
1181067946 22:20315480-20315502 CCATGGGGCCAGGGCGCGGAGGG + Intronic
1181236639 22:21451062-21451084 CCGGGGTGGGAGAGGGCAGAGGG - Exonic
1181530152 22:23512815-23512837 AGGTGGGGTCAGAGGGCAGATGG + Intergenic
1181688490 22:24545056-24545078 CCAGAGGGACAGAGGGCAGATGG + Intronic
1181807448 22:25383639-25383661 TCCTGGAGCCACAGGGCAGAGGG + Intronic
1182358228 22:29732149-29732171 GCGTGGGGCCCAAGGCCAGAAGG - Intronic
1183320952 22:37164729-37164751 CCGAGGCTCCAGAGAGCAGAGGG + Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183553445 22:38506804-38506826 CGGTGGGGCGAGAGGGCTGGCGG - Intronic
1184094146 22:42307470-42307492 CCGTGAGGGCAGAGATCAGAGGG - Intronic
1184224389 22:43120823-43120845 GCCTGGGCCCAGAGGCCAGATGG + Intronic
1184394058 22:44222236-44222258 ACATGGGCCCAAAGGGCAGAGGG + Intergenic
1184762344 22:46551646-46551668 CCGTGTGGCCAGAGAGCTGGAGG - Intergenic
1185333269 22:50261021-50261043 CCGTGGGTCCCCAGGGGAGAAGG - Intronic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
954275652 3:49540025-49540047 CCGTGGGGCCGGCGGGCGGGCGG + Intergenic
954800413 3:53183840-53183862 GTGAGGGGCCAGTGGGCAGAGGG + Intronic
959501117 3:107107004-107107026 TCGCGGAGCCAGAGGGCAGGAGG - Intergenic
960573415 3:119206797-119206819 CCCTGGAGCCAGAAGGAAGAGGG - Intergenic
961204299 3:125068618-125068640 CAGTGGGGCAAGAGGGGTGAAGG + Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961387408 3:126530282-126530304 CCCAGGGGCCAGTGGGTAGAAGG - Intronic
961593198 3:127996196-127996218 CCCTGGGGCCCCAGGACAGATGG - Intergenic
961594693 3:128006953-128006975 AGGTGGGGCCAGAGTGCTGACGG - Intergenic
961677689 3:128577684-128577706 CTGTTGGGGCAGAGGGCAGGTGG - Intergenic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
963015198 3:140817269-140817291 CAGTGGGGGCAGGGGGCATATGG + Intergenic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
964645628 3:158956153-158956175 AGGAGGGGCCTGAGGGCAGAGGG + Intergenic
966562387 3:181337407-181337429 ATGTGGGGCCAGAGGGTATATGG + Intergenic
966937825 3:184725414-184725436 CTGTGGAGCCAAAGGCCAGATGG + Intergenic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
967266414 3:187696064-187696086 ACGTGGGGCCTGAGAGCTGAAGG - Intergenic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968529707 4:1084959-1084981 CCGTGGGGCCTGTGGGAAGCTGG - Intronic
969284437 4:6194097-6194119 CCAAGGAGACAGAGGGCAGATGG + Intronic
969520713 4:7676275-7676297 AGGTGGGGTGAGAGGGCAGAGGG - Intronic
976307021 4:83570199-83570221 GCCTGGGGCCAGAGAGAAGAAGG - Intronic
980281738 4:130731967-130731989 ATGTGAGGCCAGAGGGCAAACGG + Intergenic
985706791 5:1406135-1406157 GAGTGGGGGCAGTGGGCAGACGG + Intronic
986350038 5:6868716-6868738 CCGTGGGTGCAGGGGTCAGATGG + Intergenic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
988473568 5:31563602-31563624 TCGTGTGGCCAGAGGTCACAAGG + Intergenic
988695975 5:33623249-33623271 CAGTAGGGCCTGAGGGGAGAGGG - Intronic
994182519 5:96783090-96783112 CCGTGCGTACAGAGGGCAGAAGG - Exonic
997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG + Exonic
999194774 5:149774480-149774502 TCGTGGGACCAGAAGCCAGAAGG - Intronic
999217165 5:149944889-149944911 CTGTGGGGCCAGATGGGAGAAGG + Intergenic
1000847970 5:166304947-166304969 GGGTGGGGCCATAGGGCTGATGG + Intergenic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1004374439 6:15079402-15079424 CCGTGGGGTCGGAGGTCAGTAGG - Intergenic
1004959763 6:20773901-20773923 TGATGGGGGCAGAGGGCAGAGGG - Intronic
1005822297 6:29607891-29607913 CAGTGAGGCCAGAGTGCAGCTGG - Intronic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007232578 6:40358737-40358759 CCATGGGGCCAAAGTGCAGAGGG - Intergenic
1007766677 6:44164754-44164776 TCGTGGGGCCAGATGGCAGGTGG + Intronic
1008572503 6:52829270-52829292 CCGTGGGGGCAGGGGGCCGGGGG + Intergenic
1008832980 6:55791741-55791763 ACGTGGAGCAAGAGGGAAGATGG + Intronic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1011278814 6:85656478-85656500 GCGTGGGGCAAGAGTGCAAATGG + Intergenic
1011582192 6:88881298-88881320 AAGTGGGGGCAGGGGGCAGAGGG + Intronic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012447774 6:99324029-99324051 CCATGGGGGCACAGGGCAGGAGG + Intronic
1012475793 6:99613802-99613824 CCGGGGGGACGGAGAGCAGAGGG - Exonic
1012896689 6:104957239-104957261 CCGTGGGGCAACATGGCCGAAGG + Exonic
1013330371 6:109094783-109094805 CCGCCGAGCCAGAGGGCACAGGG + Exonic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015283225 6:131456583-131456605 CCGTGGGTCCCAAGAGCAGAAGG + Intergenic
1017948544 6:159116459-159116481 CCGTGGGGCCAGAGCCCAAAAGG + Intergenic
1018855209 6:167669893-167669915 CCCTGGGGCCAGAGTGCTGGGGG - Intergenic
1018913427 6:168117510-168117532 CCGTGGGGCCAGAGGGCGCTGGG + Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019329493 7:455614-455636 GCGTGGGGGCGGGGGGCAGAGGG - Intergenic
1019333834 7:473372-473394 CCCTGGGTCCAGGAGGCAGACGG + Intergenic
1019511834 7:1421616-1421638 CCCGAGGGCCAGGGGGCAGATGG + Intergenic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1019601260 7:1884857-1884879 CCGTGGGGCAAGGGGGCAGAGGG + Intronic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1024063630 7:45716141-45716163 CCGTGAGGTCCTAGGGCAGAAGG + Exonic
1025092945 7:56078275-56078297 CCTGGGGGCCAAATGGCAGAAGG - Intronic
1026156137 7:67827420-67827442 CTGAGGGGCCACAAGGCAGAAGG - Intergenic
1026854282 7:73742923-73742945 CCGTGGGGACCAAGGGCCGAAGG + Intergenic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027199510 7:76054352-76054374 CCCTTGTGCAAGAGGGCAGATGG - Intronic
1027268996 7:76510235-76510257 GGGTGGGGACAGAAGGCAGAGGG + Intergenic
1027473060 7:78596393-78596415 TCTTGGGGCCAGAGGACTGATGG - Intronic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033951315 7:146788193-146788215 CCGTGTGGCCTGAGAGCAGAGGG + Intronic
1034678805 7:152912087-152912109 CTGTGGGGCCCAAGGGCAGGAGG + Intergenic
1035756110 8:2034211-2034233 AGGTGGGGCCAGAGCCCAGATGG - Intergenic
1035836160 8:2754410-2754432 GGGTGGGGCCAGAGGGTAGATGG + Intergenic
1037150032 8:15626109-15626131 CCTTGGGGACACAGGGCACAGGG - Intronic
1037837674 8:22223877-22223899 CCCTGGGGCCAAAGGGAAGGTGG - Intronic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039305199 8:36254595-36254617 CCGTGAGGCCAGAAGCAAGATGG - Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1041219439 8:55634026-55634048 CCATGGGGCCAAAGGGAGGATGG - Intergenic
1041468360 8:58180605-58180627 GAGTGGGGCCAGAGAGCAGAAGG + Intronic
1041719237 8:60961415-60961437 CCGTGGGGCCTGAGGACAGCTGG - Intergenic
1042785085 8:72537364-72537386 CCGCGGGGGCGGAGGGCGGAGGG - Intergenic
1046784890 8:118255126-118255148 CCGTGGGGGCAGACTACAGAAGG + Intronic
1048935253 8:139349870-139349892 CCCTGGGGCCAGAAGCCAGAGGG - Intergenic
1049363546 8:142225555-142225577 CCCTGTGGTCAGAAGGCAGAGGG - Intronic
1049472311 8:142781969-142781991 CCCTGGAGGCACAGGGCAGAGGG + Intergenic
1049577037 8:143394250-143394272 CTGTGGGGCCAGGGGGCTGTGGG + Intergenic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1049665812 8:143841946-143841968 CCGTGGGGGCTGTGGGCTGAAGG - Intergenic
1049745087 8:144259864-144259886 CCCTGGGGTCAGCGGGGAGAGGG + Intronic
1053286201 9:36850964-36850986 CTGTGGGGGCAGAAGGCAGGTGG + Intronic
1053481868 9:38422082-38422104 GAGTGAGGCCAGATGGCAGATGG - Intronic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057037888 9:91824937-91824959 CCTTGGGGCCAGCGGGCCGGGGG - Intronic
1057629882 9:96711032-96711054 CCGTGGAGCCTGGGGGCAGCTGG - Intergenic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1058843608 9:108934254-108934276 CAGATGGGCAAGAGGGCAGAGGG - Exonic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1060504042 9:124184815-124184837 ATGTGGGGGCAGAGGGCATATGG - Intergenic
1060987539 9:127828414-127828436 CCCTGGGGCCGGTGGCCAGAGGG - Intronic
1061138600 9:128751010-128751032 CCCTGGGGACAGGGTGCAGAAGG + Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1061250223 9:129422059-129422081 AGGTGGGGTCAGAGGGCAGATGG - Intergenic
1061501851 9:131008674-131008696 CTGTGGGGACAGAGCGCAGCCGG + Intergenic
1061588706 9:131584433-131584455 CCGTGAGGCAGGAGGGCAGGCGG + Intronic
1061789007 9:133048803-133048825 CCTTGGGGCCCGAGGGCAGCTGG - Intronic
1061991001 9:134158748-134158770 CCCTGGGGCAAGAGGGTGGAAGG + Exonic
1062107253 9:134762458-134762480 CCATGGGGCCAGAGCACAGGAGG + Intronic
1062231537 9:135484718-135484740 CAGAGGGGCCACAGGGCAGAGGG + Exonic
1062283355 9:135761823-135761845 CCGTGGGCCCACAGGGGAAAGGG - Intronic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1062473806 9:136717962-136717984 ACGTGGGGGCTGGGGGCAGAAGG + Intronic
1185462335 X:339210-339232 CCGTGCAGGCAGAGGCCAGAGGG + Intronic
1185817474 X:3169702-3169724 CCTTGTGGACAAAGGGCAGAAGG - Intergenic
1188441012 X:30215471-30215493 CCGTGGCGTCTGAGGGCTGACGG - Intergenic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1189838245 X:45042250-45042272 CCGTGGAGGGAGAGGGGAGAGGG + Intronic
1198394129 X:136206184-136206206 CCGCGGGGCCAGATGGCCGATGG - Intronic
1198609599 X:138383182-138383204 GGGAAGGGCCAGAGGGCAGAAGG - Intergenic
1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG + Intergenic
1199961879 X:152786651-152786673 CCGCTGGACCAGAAGGCAGATGG - Intergenic
1200137494 X:153882160-153882182 CCGAGGGGTTAAAGGGCAGAGGG + Intronic