ID: 1157751154

View in Genome Browser
Species Human (GRCh38)
Location 18:50179665-50179687
Sequence AATGCACCCCTGCTGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157751152_1157751154 -3 Left 1157751152 18:50179645-50179667 CCAGCACTAGCACAGAAGGCAAT 0: 1
1: 0
2: 0
3: 19
4: 203
Right 1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG 0: 1
1: 0
2: 0
3: 16
4: 133
1157751150_1157751154 2 Left 1157751150 18:50179640-50179662 CCTTGCCAGCACTAGCACAGAAG 0: 1
1: 0
2: 0
3: 19
4: 173
Right 1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG 0: 1
1: 0
2: 0
3: 16
4: 133
1157751149_1157751154 26 Left 1157751149 18:50179616-50179638 CCAAGGACAAGAGTAACTGAGTC 0: 1
1: 0
2: 0
3: 16
4: 128
Right 1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG 0: 1
1: 0
2: 0
3: 16
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157751154 Original CRISPR AATGCACCCCTGCTGCTGAT GGG Intronic
900075100 1:808092-808114 CATGAACCCCTGATGCTGATGGG - Intergenic
901600874 1:10422506-10422528 AATTCACCACTGGTGCTGAGAGG - Intergenic
905347413 1:37320248-37320270 AATGCGCCCCTGGTGCTGGAGGG + Intergenic
909948511 1:81690994-81691016 AATTTTCCCCTGCTGCTGATTGG - Intronic
913072959 1:115317761-115317783 AATGCATCCCTGCCGCTGGCAGG + Intronic
914988310 1:152478248-152478270 AAAGCACCCCTCCTCCTGTTAGG - Intergenic
914988318 1:152478287-152478309 AAAGCACCCCTCCTCCTGTTAGG - Intergenic
917079025 1:171237491-171237513 GATGCAGCCATGATGCTGATCGG - Intergenic
917412053 1:174769233-174769255 AATGGATACTTGCTGCTGATTGG + Intronic
921505435 1:215963265-215963287 AATGTCACCCAGCTGCTGATGGG + Intronic
921938538 1:220816672-220816694 AGTGCACCCCTCCTGCTAACTGG - Exonic
922251613 1:223854379-223854401 AGTGCTCCCCTTCTGATGATTGG + Intergenic
922270940 1:224032991-224033013 CATGAACCCCTGATGCTGATGGG - Intergenic
923246840 1:232140540-232140562 GGTGCAGCCCTGCTGCTCATCGG - Intergenic
924200883 1:241657307-241657329 AAAGCACACTTGCTGCTGCTAGG - Intronic
924470943 1:244342081-244342103 AATGATCTCCTGCTGCTGACGGG + Intergenic
1062980205 10:1715882-1715904 CCTGCAGCCCTGCTGCTGTTCGG - Intronic
1065312962 10:24433948-24433970 AATGGACTCCTGCTATTGATGGG + Intronic
1066249158 10:33616175-33616197 AATGGGCACTTGCTGCTGATTGG - Intergenic
1066282245 10:33928753-33928775 TATGGACCCCTGGTGCTAATTGG - Intergenic
1066324857 10:34348163-34348185 AATTCTCCCATGCTGCTAATTGG - Intronic
1068669941 10:59712114-59712136 AATGCTCCCCTGCAGATGATGGG - Intronic
1070765197 10:79052429-79052451 AATGCACCCGTGCTGCCGCCAGG - Intergenic
1072631549 10:97150331-97150353 AATGCCCTCCTGCCTCTGATGGG + Intronic
1074026640 10:109642587-109642609 AAAGAATCCCTGCTGCTGCTGGG - Intergenic
1074176549 10:111010718-111010740 AATCTAGCCCTGCTGCTTATTGG + Intronic
1074919936 10:117997864-117997886 AATGCTTCCCTACTGCTTATAGG - Intergenic
1076336012 10:129706805-129706827 AATCCACCCCTGCTGGAGATGGG + Intronic
1076457542 10:130611182-130611204 AGTGCACCCTTGCTTTTGATAGG + Intergenic
1077754183 11:5007692-5007714 AATGGGTGCCTGCTGCTGATTGG + Intergenic
1079478621 11:20858030-20858052 AATGCACCCATCCTGCTATTGGG - Intronic
1080921260 11:36711574-36711596 AATGCAACCCTGCTTCAGAAAGG - Intergenic
1081867223 11:46366569-46366591 GGTGCACCCCTGCTGTTGACCGG + Exonic
1083772758 11:64877765-64877787 ACTGCGGCCCTGCTGCTGAGGGG + Intronic
1084231103 11:67753935-67753957 AAGTCTCCCTTGCTGCTGATGGG - Intergenic
1088653121 11:111976092-111976114 AAAGCACACCTGCTGCTTAATGG - Intronic
1088861405 11:113803216-113803238 AATGCTGCCCTGCTGATGAAGGG - Exonic
1091207271 11:133830492-133830514 ACTACACCCATGCTGCTGGTTGG + Intergenic
1095562280 12:43580181-43580203 AATACACTCCTTCAGCTGATGGG + Intergenic
1097430534 12:59499710-59499732 AATGGATGCCTGCTGATGATTGG - Intergenic
1100383360 12:94083119-94083141 AATACACCCCCACTGCTGTTTGG + Intergenic
1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG + Intergenic
1104320127 12:127742978-127743000 AATGGGTGCCTGCTGCTGATTGG + Intergenic
1111611980 13:90616725-90616747 AATGCACCCATCCTGCTATTGGG + Intergenic
1113680012 13:112236792-112236814 TACGCACCCCTTCTGCTCATGGG + Intergenic
1114833048 14:26168256-26168278 AATGCACTCCTGCTTATGAAAGG - Intergenic
1121399075 14:93656156-93656178 AACTCACCCCTGCTGCAGAAGGG - Intronic
1124070021 15:26382368-26382390 AATGGACAGCTGCTGCTGCTGGG - Intergenic
1124689237 15:31807945-31807967 GAAGCTTCCCTGCTGCTGATAGG + Intronic
1125648762 15:41295642-41295664 GAAGCAGCCCTGCTGCTCATAGG + Intergenic
1128214349 15:65924103-65924125 ACTGCTCTCCTGCTGCTGGTAGG - Intronic
1133355656 16:5134829-5134851 AATGCACTCATGCTGTTGGTTGG + Intergenic
1135465528 16:22681568-22681590 AATGCTCGCCTGCTGCTGGCTGG + Intergenic
1138777212 16:59737689-59737711 AATTCACCCCAGCTTCTAATGGG + Intronic
1144753954 17:17668368-17668390 AGTGCACCCTGGCTGCTGAGAGG - Intergenic
1146889641 17:36498102-36498124 AATCCAAACCTGCAGCTGATTGG + Intronic
1149477502 17:56975402-56975424 AATGGATGCTTGCTGCTGATTGG - Intergenic
1149796183 17:59522175-59522197 AATGCACCCGGCCTGATGATTGG - Intergenic
1152009709 17:77704700-77704722 AAGGCCCCCCTGCAGCTGTTGGG - Intergenic
1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG + Intronic
1158403813 18:57143706-57143728 GATGCACACCTGCAGCTGCTCGG + Intergenic
1161045590 19:2132718-2132740 TTAGCACCCCTGCTGCTGAGGGG + Intronic
1161524936 19:4748363-4748385 AATGCACCCCTGCACCTGCCTGG + Intergenic
1164435316 19:28223588-28223610 AATGCACCCCTGCTACCGGGTGG - Intergenic
1164556677 19:29258416-29258438 AATGCTCCCCTGGTGCTTCTGGG + Intergenic
1166385116 19:42376431-42376453 CTGGCACCCCTGCTGCTGACAGG + Exonic
926835435 2:17014080-17014102 AATGCCCTCCTGCTGCTGTTTGG - Intergenic
929580500 2:43079099-43079121 AATGCACGTCTGCTGCTGGGTGG - Intergenic
931954081 2:67397958-67397980 ACTCCACCACTGCTGCTGACTGG - Intronic
938340324 2:130531789-130531811 AAAGCTCCCCTGATGCTGGTGGG + Intergenic
938349506 2:130588949-130588971 AAAGCTCCCCTGATGCTGGTGGG - Intergenic
938568386 2:132540691-132540713 ATAGCACCCTTGCAGCTGATGGG - Intronic
939456966 2:142449725-142449747 GATGCACCTCTGCTGCAGTTGGG + Intergenic
939894461 2:147775100-147775122 AATGGACTCCTCCTACTGATTGG - Intergenic
941201448 2:162516347-162516369 AATGGGTCCCTGCTGCTGAGTGG + Intronic
942616601 2:177797211-177797233 AATGCTCTCCTGCAACTGATAGG + Intronic
945816641 2:214613024-214613046 GATGCTCCCCTGCTTATGATGGG - Intergenic
949082623 2:242116692-242116714 CATGAACCCCTGATGCTGATGGG + Intergenic
1170368958 20:15627527-15627549 AATGGATGCTTGCTGCTGATTGG + Intronic
1170601936 20:17848138-17848160 AAGGCACCCCTGCTCCTGGAAGG - Intergenic
1170673808 20:18460058-18460080 AATGCAGCACTGATTCTGATAGG + Intronic
1175575365 20:60056960-60056982 AGTGCTCCCCTCCTCCTGATTGG + Intronic
1175844315 20:62050685-62050707 GGCACACCCCTGCTGCTGATAGG + Intronic
1177446627 21:21205732-21205754 AATACATCTCTGCTGCTTATAGG - Intronic
1178428605 21:32499463-32499485 AAGTCTCCCTTGCTGCTGATGGG + Intronic
1179942554 21:44649393-44649415 AGTGTACCCCTCCTGCTGAGAGG - Intronic
950150957 3:10687028-10687050 AATACACAGCTGCAGCTGATAGG + Intronic
950723578 3:14901314-14901336 AAAGCACCCCAGGTGCTGATGGG - Intronic
955650174 3:61185556-61185578 AAAGCACCTCTGCTGCTGAATGG - Intronic
957060338 3:75476261-75476283 AATGCACTCATGCTGTTGGTTGG + Intergenic
959162537 3:102738893-102738915 AATGCACCCATCCTGCTATTGGG - Intergenic
961293054 3:125863149-125863171 AATGCACTCATGCTGTTGGTTGG - Intergenic
961879725 3:130052951-130052973 AAGTCTCCCTTGCTGCTGATGGG - Intergenic
965669380 3:171131022-171131044 TAAGCATCCCTGCTGCTAATAGG + Intronic
967373800 3:188778496-188778518 AATCCAACCCTGCTGTAGATAGG + Intronic
967627572 3:191703585-191703607 GCTGCAGCCCTGCTGCTGGTGGG - Intergenic
968991931 4:3920060-3920082 AAGTCTCCCTTGCTGCTGATGGG - Intergenic
969823407 4:9737619-9737641 AAGTCTCCCTTGCTGCTGATAGG + Intergenic
970102195 4:12537489-12537511 CATGCAGCCCTGCTGCTGTCTGG - Intergenic
970540286 4:17071054-17071076 AAAGCACCTCTGTTGCTAATGGG + Intergenic
974160441 4:58131513-58131535 AATGTGACCCTCCTGCTGATTGG - Intergenic
976528747 4:86125513-86125535 TATGCTCCCCTGCTGCTCAAGGG + Intronic
979072850 4:116232167-116232189 TATTCAGCCCTTCTGCTGATTGG - Intergenic
983250543 4:165340778-165340800 AATGCATCCTTTCTGTTGATTGG + Intronic
986622720 5:9692279-9692301 AGTGCACCCTTGCTCCAGATTGG + Intronic
987224075 5:15821470-15821492 ATTCCACCCCTGCTGCTGAATGG + Intronic
988687406 5:33538450-33538472 CATGCCTCCCTGCTTCTGATTGG + Intronic
989336584 5:40324333-40324355 AATGATCCCCTGCTGCTGTCTGG + Intergenic
992564445 5:77984312-77984334 AATCTACCCCTCCTCCTGATTGG - Intergenic
992951150 5:81859123-81859145 AAAGCAACCATGCTGCTGATTGG - Intergenic
996088348 5:119326528-119326550 AATGCTTCCCTGCTGCTCAGGGG - Intronic
1003280227 6:4684768-4684790 CAGGCACCCCTGCTGCTGTGAGG - Intergenic
1004453698 6:15771319-15771341 CATGAACTCCAGCTGCTGATGGG + Intergenic
1009353781 6:62714280-62714302 AAGGCACTCCTGCTCCTTATAGG + Intergenic
1009879031 6:69541820-69541842 AGTGCACCACTTCTGCTGACAGG + Intergenic
1012497352 6:99848609-99848631 GATGCACTCCTGCTGCTGAAAGG + Intergenic
1018322015 6:162621312-162621334 ATTGCACTCCTGCTGCTCTTAGG + Intronic
1018579158 6:165292788-165292810 ACAGCACCCGTGCTGCTCATAGG + Intronic
1020747112 7:12091970-12091992 AATGCACCCATCCTGCTATTGGG - Intergenic
1026679165 7:72452262-72452284 ACTGTACCACTGCTGCAGATGGG - Intergenic
1028270769 7:88786057-88786079 ATTGTACCCCTGCTGATGCTTGG + Intronic
1029585317 7:101467080-101467102 ACAGCATCCCTGTTGCTGATGGG - Intronic
1033501289 7:141952550-141952572 AGTGCATCTCTGCTGCTGGTAGG - Intronic
1035540547 8:433395-433417 CATGAACCCCTGATGCTGATGGG + Intronic
1035753306 8:2010704-2010726 GATGCGGCCCTGCTGCTGGTGGG + Intergenic
1035853352 8:2944363-2944385 GCTGCACCACTGCTGCTGCTGGG - Intronic
1037538663 8:19851337-19851359 TATGCATCCCTACTGCTGACTGG - Intronic
1037677788 8:21066797-21066819 AATGAACCTCTGCTGCTTCTGGG - Intergenic
1046058248 8:109104647-109104669 GATGTACCTCTGCTACTGATGGG - Intronic
1046476434 8:114750754-114750776 AATTCACATCTGCTGCTGATAGG + Intergenic
1048127866 8:131657095-131657117 AAAGCACCCCTGCTGATGAGAGG + Intergenic
1048711174 8:137212624-137212646 AAAGATTCCCTGCTGCTGATGGG + Intergenic
1049960116 9:730158-730180 AAGGCATCCAGGCTGCTGATTGG - Exonic
1055336505 9:75237672-75237694 AATGCACCCATCCTGCTATTGGG + Intergenic
1055391485 9:75826615-75826637 AATTCATGCCAGCTGCTGATTGG - Intergenic
1055998912 9:82193571-82193593 AATGAATACTTGCTGCTGATTGG - Intergenic
1057198749 9:93129437-93129459 CATGCACCCCTGCTGGTGAAGGG + Intronic
1059875440 9:118629260-118629282 TTTCCACCACTGCTGCTGATGGG - Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1061896036 9:133648164-133648186 AAGGGAACCCTGCTGCTGAGAGG + Intronic
1185998285 X:4978011-4978033 ATTGCCCCCCTGCTGTTGGTGGG - Intergenic
1186021686 X:5263733-5263755 AATGCGTGCTTGCTGCTGATTGG + Intergenic
1187015259 X:15320881-15320903 AATGCACCCCTGGTCCTTAATGG + Exonic
1187590422 X:20711596-20711618 CATGCACACCTGCTCCTGGTGGG - Intergenic
1190380863 X:49838647-49838669 AGTGAACCCATGCTGCTAATTGG - Intergenic
1190890519 X:54563282-54563304 AATGCACCTCTACTTATGATGGG + Intergenic
1198068725 X:133126751-133126773 AAAAAAACCCTGCTGCTGATAGG - Intergenic
1200097895 X:153672689-153672711 AAGGCACCCCTGCCGCAGACGGG + Exonic
1200975225 Y:9205153-9205175 AGTGCACCACCGCAGCTGATAGG - Intergenic
1202135927 Y:21661366-21661388 AGTGCACCACTGCAGCTAATAGG + Intergenic