ID: 1157752040

View in Genome Browser
Species Human (GRCh38)
Location 18:50187820-50187842
Sequence CCAATGTTCTTCAAGTGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157752036_1157752040 22 Left 1157752036 18:50187775-50187797 CCAAAGTGCTAGGATTACAGGTG 0: 6033
1: 84644
2: 218857
3: 252033
4: 196794
Right 1157752040 18:50187820-50187842 CCAATGTTCTTCAAGTGTCAAGG 0: 1
1: 0
2: 0
3: 21
4: 144
1157752035_1157752040 23 Left 1157752035 18:50187774-50187796 CCCAAAGTGCTAGGATTACAGGT 0: 6328
1: 96058
2: 316692
3: 235985
4: 141398
Right 1157752040 18:50187820-50187842 CCAATGTTCTTCAAGTGTCAAGG 0: 1
1: 0
2: 0
3: 21
4: 144
1157752033_1157752040 26 Left 1157752033 18:50187771-50187793 CCTCCCAAAGTGCTAGGATTACA 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
Right 1157752040 18:50187820-50187842 CCAATGTTCTTCAAGTGTCAAGG 0: 1
1: 0
2: 0
3: 21
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157752040 Original CRISPR CCAATGTTCTTCAAGTGTCA AGG Intronic
906050947 1:42871317-42871339 CCAATGATTTCAAAGTGTCAGGG + Intergenic
906801220 1:48738772-48738794 CCAATGTTCTACAAGAGAAAAGG + Intronic
909236095 1:73153871-73153893 CCCATGATCTTCATGTGTCATGG - Intergenic
910106754 1:83639557-83639579 CCTAGGTTCTTTAAGTGACATGG - Intergenic
910477755 1:87624777-87624799 GCAAAGGTCTTCAAGTGTCTGGG + Intergenic
911109765 1:94170381-94170403 CCAATCCTCCTCAAGTGTCAAGG + Intronic
911794105 1:102054723-102054745 CCAATGTGCATGAAGTGTCTTGG + Intergenic
911830884 1:102550348-102550370 CCCATGATCTCCATGTGTCATGG - Intergenic
912922661 1:113884348-113884370 ACCATAGTCTTCAAGTGTCAAGG + Intronic
913322245 1:117596954-117596976 TCGATGTTTCTCAAGTGTCAAGG - Intergenic
913718969 1:121572059-121572081 CCTTTGTTCTTCATGTTTCATGG + Intergenic
915190687 1:154147957-154147979 CCAACACTCTTTAAGTGTCAAGG + Intronic
917036626 1:170754413-170754435 CCAATGTTCTTTAGGCCTCAAGG - Intergenic
917700960 1:177580576-177580598 CCCATGATCCCCAAGTGTCAAGG - Intergenic
918467127 1:184832014-184832036 CCATAGCTCTTCAAGTGTAATGG + Intronic
918617657 1:186564872-186564894 CTAATGTTCTTCAAGAGATAAGG + Intergenic
921529031 1:216256923-216256945 CCCATGTCGTTCAAGGGTCAAGG + Intronic
923481583 1:234390040-234390062 CCAGTACTCTTCAAGTGTCCAGG + Intergenic
1063242579 10:4186626-4186648 CCAAAGTTGTTCAAGTCCCAAGG + Intergenic
1066128744 10:32369087-32369109 CCAATGTTATTCTATTGACAAGG - Intronic
1068316941 10:55357527-55357549 TCAATGTTTTTTAAGTGTCAGGG + Intronic
1069329208 10:67271240-67271262 CCAATAATCCTCATGTGTCAAGG + Intronic
1069817156 10:71205240-71205262 CCAGTATTGTTCATGTGTCATGG - Intergenic
1076922667 10:133463009-133463031 CCAATGTTCTCCAAGTATCCTGG + Intergenic
1080306444 11:30841602-30841624 CCTATAATTTTCAAGTGTCAAGG + Intronic
1082195487 11:49299209-49299231 CCAATTTTCCTCAAGTATCAAGG + Intergenic
1084473848 11:69377881-69377903 CCCATGGCCTTCAAGTGTCAGGG + Intergenic
1086540453 11:87903487-87903509 CCAATATCCTTCAAGAGTGAAGG - Intergenic
1086582535 11:88415579-88415601 CTAGTGGTTTTCAAGTGTCAAGG + Intergenic
1086602893 11:88656985-88657007 CCAATGCTCTGCAAATATCAAGG + Intronic
1086660449 11:89410343-89410365 CCAATTTTCCTCAAGTATCAAGG - Intronic
1086769653 11:90745785-90745807 CCCATTATCTTCATGTGTCAAGG + Intergenic
1086895359 11:92305749-92305771 CTAATACTCTTCAAATGTCAAGG + Intergenic
1087730196 11:101769456-101769478 CCCATGATCCCCAAGTGTCATGG - Intronic
1087917120 11:103823744-103823766 CCCATGATCCTCACGTGTCAAGG + Intergenic
1099076464 12:78114645-78114667 CCCATAATCTTCACGTGTCATGG - Intronic
1099320891 12:81147270-81147292 ACTAAGTTCTACAAGTGTCAAGG + Intronic
1100513246 12:95298278-95298300 ACAATGTTCCTCTAGTGTGAGGG - Intronic
1100946231 12:99787186-99787208 CCCATAATCTTCATGTGTCATGG + Intronic
1103177127 12:118873976-118873998 CAGATGTTATTCAAGGGTCAGGG + Intergenic
1108150351 13:47527357-47527379 TAAATGTGCTTCCAGTGTCACGG + Intergenic
1109170462 13:59090147-59090169 CCTGTATTCTTCAAATGTCAAGG - Intergenic
1109463468 13:62695002-62695024 CCAATGTCCTTCAAGTGAGAAGG + Intergenic
1109718211 13:66244935-66244957 CCCATAGTCCTCAAGTGTCAAGG + Intergenic
1110069822 13:71160774-71160796 CAAATGTTTTTCAATTGTTAAGG + Intergenic
1111047503 13:82833837-82833859 CCAATGTACATCAAGTCTAATGG - Intergenic
1114707316 14:24740357-24740379 CCAAGGTTCTTCAAGATTCAAGG + Intergenic
1120529918 14:85619570-85619592 GAAATGTTATTTAAGTGTCAAGG - Intronic
1122166523 14:99829013-99829035 CCAGTGTTGTTCAACTGTCTAGG + Intronic
1122334921 14:100966826-100966848 CCAATGTTATTCCAGTGATATGG + Intergenic
1125235233 15:37505367-37505389 TCAATGTTCATCAAGTGTATTGG - Intergenic
1128657956 15:69476306-69476328 CCCAGCTTCTTCAAGTGTAAAGG + Intergenic
1129497349 15:75997746-75997768 GCCATGTTCTCCAGGTGTCAGGG - Intronic
1137465091 16:48700473-48700495 CCAAGGTTCCTGAAGTGTCTGGG - Intergenic
1139213255 16:65101665-65101687 ACTATCTTCCTCAAGTGTCAAGG + Intronic
1140436622 16:74952130-74952152 CCTATGTTTTTAAAGTGACACGG - Intronic
1140639749 16:76958274-76958296 CCCATAATCTTTAAGTGTCATGG - Intergenic
1145110522 17:20157260-20157282 CCAATGTACCCCAAGTGTCAGGG - Intronic
1155515278 18:26618254-26618276 CAAGTGTTGTTCAAGTGTGAGGG + Intronic
1156265735 18:35487275-35487297 CCAGTACTCTTCAAGTGTCAAGG + Intronic
1157752040 18:50187820-50187842 CCAATGTTCTTCAAGTGTCAAGG + Intronic
1158888592 18:61852228-61852250 ACAATATTCCTCAAGTCTCAAGG + Intronic
1161359252 19:3837663-3837685 ACAGTGTTCATCGAGTGTCACGG - Intronic
925092353 2:1166159-1166181 CTAATGTTATTCAGCTGTCATGG + Intronic
926464963 2:13176703-13176725 CCAATAATCTCCATGTGTCAAGG - Intergenic
930981372 2:57529689-57529711 CCCATAATCTTCATGTGTCAAGG - Intergenic
931902810 2:66807745-66807767 AAAATGCTCATCAAGTGTCAGGG + Intergenic
931921511 2:67021494-67021516 CCAATATCCTTGAAGAGTCAAGG + Intergenic
933525048 2:83426609-83426631 CCAAGGTTCTGAAAGAGTCAAGG + Intergenic
934995966 2:98960714-98960736 CCCATGTTGTTCAAGGGCCAAGG - Intergenic
936081650 2:109436508-109436530 CCAATGTGCTGGATGTGTCAAGG + Intronic
939251235 2:139684113-139684135 CAAGTTTTCTTCATGTGTCATGG + Intergenic
939479587 2:142731559-142731581 CCAATGTTCATCAAGGGTATTGG - Intergenic
940579304 2:155557355-155557377 CCAATGTTCTTCAAGGATACTGG - Intergenic
941839595 2:170066524-170066546 TTAATGTTCTTCAAGTTTTATGG - Intronic
942964726 2:181877720-181877742 CCAATGTGCTTAAATTTTCAGGG - Intergenic
943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG + Intergenic
943423594 2:187700031-187700053 CCAATAATCCTCATGTGTCATGG + Intergenic
945186617 2:207146373-207146395 CCTATGCTCTTCAAGTACCAAGG + Intronic
946718908 2:222583548-222583570 CCTGTAATCTTCAAGTGTCAAGG + Intronic
1170300024 20:14873040-14873062 TCCATATTCTTCATGTGTCAAGG - Intronic
1172746583 20:37214590-37214612 CCCATCCTCTTCAAGTGTCAAGG - Intronic
1177932217 21:27298972-27298994 ACCATGTTCCTCAAGTCTCAAGG + Intergenic
1179609514 21:42540798-42540820 CCAAACTTTTTCAAGTGTTATGG - Intronic
1182098152 22:27639520-27639542 CAAATGATCTCCATGTGTCACGG - Intergenic
1183106163 22:35616755-35616777 TAAATGCTCTTAAAGTGTCAAGG - Intronic
949332268 3:2935621-2935643 TCAAGGTTCTACATGTGTCACGG + Intronic
951017584 3:17746963-17746985 CGAATGTTCTTAAAGTCTCTTGG + Intronic
951059657 3:18190256-18190278 CCAATATTGTTCAACTGTCAGGG - Intronic
951354522 3:21648127-21648149 CCAATAATCTGCACGTGTCAAGG + Intronic
952719798 3:36520832-36520854 TAAATGTTCTTGAACTGTCATGG - Intronic
955418303 3:58713253-58713275 CCCATGTTCTCCAAATCTCACGG - Intergenic
955661389 3:61303138-61303160 CTTATGTTCTCAAAGTGTCAGGG + Intergenic
957548484 3:81671928-81671950 ACAATGTTCTTCATGTATTATGG - Intronic
958713105 3:97741982-97742004 GTAATGTTCTTCAAGTGGCTGGG - Intronic
958790912 3:98650035-98650057 AAGCTGTTCTTCAAGTGTCAAGG - Intergenic
959870068 3:111316356-111316378 CCAATGATATTAAAGTGGCAAGG + Intronic
960469179 3:118039901-118039923 TCAATCTTTTTCAAGTTTCAGGG - Intergenic
965176023 3:165333691-165333713 ACAATGTTCTGCAAGTGGAAAGG - Intergenic
970753593 4:19396628-19396650 TCAATGTTCTTCAAGGGTATTGG - Intergenic
974022946 4:56707759-56707781 CCCATAATCCTCAAGTGTCACGG - Intergenic
976003530 4:80401006-80401028 CCAATGTTCCACAAATGTCTAGG - Intronic
978008638 4:103651517-103651539 AAAATGTTGTCCAAGTGTCAAGG + Intronic
985806223 5:2045448-2045470 GCAATGATCTGCAAGGGTCATGG - Intergenic
985987531 5:3528984-3529006 CCAATTATCTTCATGTGTCACGG + Intergenic
986216718 5:5726220-5726242 CCAGTGACCTACAAGTGTCAAGG - Intergenic
986833739 5:11611020-11611042 CCCATATTCTCCATGTGTCATGG + Intronic
987897403 5:23965220-23965242 CCCATGTTCCCCATGTGTCATGG - Intronic
989959627 5:50396018-50396040 CCCTTGTTCTTCATGTTTCATGG - Intergenic
989996543 5:50839815-50839837 CTAATGCTTTTTAAGTGTCAGGG + Intronic
991453625 5:66779291-66779313 CCAATGATCTCCAACTGACAAGG - Intronic
995361191 5:111299236-111299258 CTAATGTACTTCATGTGACATGG - Intronic
997056418 5:130450029-130450051 CCTATGGTCCCCAAGTGTCAAGG + Intergenic
998808725 5:145943998-145944020 AGAATGCTCTTCAAGAGTCAAGG - Intronic
1000232035 5:159324995-159325017 ACCATGCTCTTCAGGTGTCAGGG - Intronic
1000991746 5:167918359-167918381 CTGATGGGCTTCAAGTGTCAGGG - Intronic
1002944643 6:1749795-1749817 TAAATTTTCTTCAAATGTCATGG + Intronic
1004131284 6:12922111-12922133 TCAATGTTCTGCAAATGACATGG - Intronic
1004492271 6:16128717-16128739 CCACTGTTCTTCAAATATCTTGG - Intergenic
1004498138 6:16184067-16184089 CCTTTTTTCTCCAAGTGTCATGG - Intergenic
1007538462 6:42618357-42618379 TCAAGGATCTTCAAGTGTCCTGG - Intronic
1007594734 6:43044564-43044586 CCCATGTCTCTCAAGTGTCAGGG - Intronic
1007951457 6:45876187-45876209 CCAATATTCTTCTTGTCTCATGG + Intergenic
1010906681 6:81500301-81500323 CCAATAATCCTCAAATGTCATGG + Intronic
1013582011 6:111545075-111545097 CCCATATTCTTGAAGTGTTAAGG - Intergenic
1014587352 6:123215678-123215700 CAAATGTTCTTCAGTTTTCAGGG - Intergenic
1014851754 6:126349070-126349092 CTTATTTTCTTCAAGTCTCATGG + Intergenic
1016377572 6:143438975-143438997 CCACTGTTCTTGAAGTGCCAGGG + Intronic
1016710425 6:147165140-147165162 CCATTGTTCTACAAGTATTATGG - Intergenic
1016725192 6:147357129-147357151 CAAATGTACTCTAAGTGTCATGG + Intronic
1017527876 6:155258712-155258734 GCATTTTTCTTCAAGTCTCAGGG + Intronic
1018067073 6:160131685-160131707 CCCATGTTCTCCAAGAGCCAAGG - Intronic
1022623958 7:32014923-32014945 CCCATAATCTTCACGTGTCAAGG + Intronic
1024798781 7:53051450-53051472 CCATTTTCCTTCAAGTGTCCTGG - Intergenic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026427683 7:70312699-70312721 CCAAAGTACTTCAAGGGTCTAGG + Intronic
1030962827 7:115948412-115948434 TCAATGTTCATCAAGTGTATTGG - Intronic
1032023881 7:128426110-128426132 ACAATGGTCTTCAAGTGTCTTGG + Intergenic
1033410294 7:141111344-141111366 CCCATAATCCTCAAGTGTCATGG - Intronic
1033410484 7:141113382-141113404 CCAATGGTTTTCAAGTCTGATGG - Intronic
1033547931 7:142418917-142418939 CCAGTGTTCTGCAAGTCTCTGGG - Intergenic
1033964935 7:146963460-146963482 ATATTGTGCTTCAAGTGTCATGG + Intronic
1037685208 8:21132850-21132872 CCAATGTTCTGGAAGTATCAAGG + Intergenic
1038626687 8:29200764-29200786 CCAGTCCTCTTCAAGTGTCAAGG - Intronic
1039845350 8:41321758-41321780 CCATTGTTCTTAAAGAGGCAGGG - Intergenic
1040685857 8:49872180-49872202 CCAATGTTCTTTAAGTTCAAAGG + Intergenic
1040733039 8:50473100-50473122 CCCACGTTCCCCAAGTGTCAAGG + Intronic
1040918002 8:52583751-52583773 TCAGTGTTCTTGAAGTGTCAAGG - Intergenic
1043377912 8:79670674-79670696 CCAATGTTCTTCATGGCTCTTGG + Intergenic
1043947427 8:86269984-86270006 CCAATGTTCTGTGAGTGTCCTGG - Intronic
1045966089 8:108026212-108026234 CCAGGATTCTTCAAATGTCAAGG + Intronic
1047080776 8:121458028-121458050 CCCATAATCCTCAAGTGTCATGG + Intergenic
1052574702 9:30277672-30277694 CCAATGTTCTTTATGTATGATGG + Intergenic
1058074848 9:100640257-100640279 TCAATTTTCTTAAAGTGACATGG + Intergenic
1058442608 9:105023836-105023858 TCAATGTTCTTGAATTGACATGG + Intergenic
1060672900 9:125485926-125485948 CTATTTTTCTTCTAGTGTCAGGG + Intronic
1061712139 9:132495565-132495587 CCAATGTTCCTCAAGAGTGATGG - Intronic
1188283577 X:28300722-28300744 CCCATAATCTTCATGTGTCAAGG + Intergenic
1189273030 X:39765010-39765032 CAAATGTCCTGCAACTGTCATGG + Intergenic
1194487891 X:94508875-94508897 AGAATGTTCTTCACCTGTCATGG + Intergenic
1196970646 X:121104690-121104712 TCAATGTTCTTAACGTGACAAGG - Intergenic
1197326603 X:125102190-125102212 CTAATGTTCACCAACTGTCAAGG + Intergenic