ID: 1157752913

View in Genome Browser
Species Human (GRCh38)
Location 18:50194658-50194680
Sequence TACTGGAGGCGGGAGGTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157752913_1157752925 11 Left 1157752913 18:50194658-50194680 CCCGTCACCTCCCGCCTCCAGTA 0: 1
1: 0
2: 0
3: 7
4: 242
Right 1157752925 18:50194692-50194714 AGGCGACCCTGAGTACTAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1157752913_1157752924 8 Left 1157752913 18:50194658-50194680 CCCGTCACCTCCCGCCTCCAGTA 0: 1
1: 0
2: 0
3: 7
4: 242
Right 1157752924 18:50194689-50194711 AGAAGGCGACCCTGAGTACTAGG 0: 1
1: 0
2: 0
3: 2
4: 84
1157752913_1157752921 -9 Left 1157752913 18:50194658-50194680 CCCGTCACCTCCCGCCTCCAGTA 0: 1
1: 0
2: 0
3: 7
4: 242
Right 1157752921 18:50194672-50194694 CCTCCAGTAGCCGAGGGAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157752913 Original CRISPR TACTGGAGGCGGGAGGTGAC GGG (reversed) Intronic
900757820 1:4449402-4449424 GACTGGAGGCGGGAGGACATGGG + Intergenic
901530401 1:9849218-9849240 TCCTGGAGGCAGGGGGTGAGGGG - Exonic
901607732 1:10472445-10472467 TTGTGGAGGATGGAGGTGACCGG - Exonic
901632210 1:10653470-10653492 TGATGGAGGCGGGTGGTGCCGGG + Exonic
902086898 1:13869633-13869655 TCCAGGAGGTGGGAGGAGACAGG - Intergenic
902174994 1:14642530-14642552 TACTGGAGGCTGGAGGGGTTGGG + Intronic
902837940 1:19058698-19058720 TGCTGGAGGACGGAGGGGACAGG - Intergenic
903469530 1:23576199-23576221 TACTGGTGGTGGGGGGTGGCAGG + Intergenic
903580637 1:24368044-24368066 GCCTGGAGGCGGGAGGTCTCTGG + Intronic
904799415 1:33082072-33082094 TGCTGGGGGCGGGTTGTGACGGG + Intronic
905246047 1:36614621-36614643 TGGGGGAGGAGGGAGGTGACTGG + Intergenic
906130463 1:43452526-43452548 TACTGGAGGCAGGAGGCGGTGGG - Exonic
914420886 1:147527404-147527426 TAATGGAGGAGGGAGAGGACAGG + Intergenic
914901028 1:151711223-151711245 TGCTGGAGCCTGGAGCTGACCGG - Intronic
915468420 1:156111854-156111876 TGCTGGAGGTGAGAGGTGATGGG - Intronic
915731072 1:158054922-158054944 GGGTGGAGGTGGGAGGTGACTGG + Intronic
916810378 1:168300496-168300518 TACATGAGGCGGGAGGTGCGTGG + Intronic
919981352 1:202644310-202644332 TTGTGGAGGTGGGAGGTGTCGGG - Intronic
921376862 1:214483471-214483493 AACTGGAGGCGGGTGGGGAAGGG - Intronic
922460520 1:225811437-225811459 GGCTGGAGGTGGGAGGTGAGGGG + Intronic
922914153 1:229241687-229241709 TGTTGAAGGAGGGAGGTGACTGG + Intergenic
923148902 1:231216871-231216893 AGCTGGAGGTGGCAGGTGACTGG - Exonic
924051121 1:240080431-240080453 TACTGGGGGGTGGAGGTGAGGGG - Intronic
924207216 1:241725636-241725658 AACTGGAGGAGGCAGGTGCCGGG - Intronic
924422947 1:243926155-243926177 TGCTGGAGGTGGGGGGTGGCGGG - Intergenic
1065011305 10:21423326-21423348 TACTGGAGGCCTGAGGTGGGAGG + Intergenic
1065030549 10:21581584-21581606 TGTTGAAGGAGGGAGGTGACTGG + Intronic
1065786425 10:29219974-29219996 TAATGTTGGTGGGAGGTGACTGG + Intergenic
1067225818 10:44375075-44375097 CGCAGGAGGCGGGAGGGGACAGG + Intronic
1068397942 10:56488016-56488038 TGCTGGAGGGGGGAGGGGGCTGG + Intergenic
1069224327 10:65923032-65923054 TATTGAGGGAGGGAGGTGACTGG - Intronic
1069532929 10:69232267-69232289 TCCTGGAGGGGAGAGGAGACAGG - Intronic
1069740774 10:70685810-70685832 TAATGGTGGTGGGAGGTGAAGGG + Intronic
1071477398 10:86036507-86036529 TTCTTGGGGCTGGAGGTGACAGG - Intronic
1072539256 10:96385774-96385796 TATTGGGGGTGGGAGGTGTCAGG - Intronic
1073327084 10:102649396-102649418 TATTGGAGGCAGGAGCTGAAAGG + Intronic
1076051504 10:127337318-127337340 TTCTGGGGGCTGAAGGTGACAGG + Intronic
1076886960 10:133267409-133267431 GACCGGAGGCTGGAGGAGACAGG + Exonic
1079210746 11:18458443-18458465 TTCTAGAAGCAGGAGGTGACTGG - Intronic
1079622369 11:22569442-22569464 TACTGAAGGCTGAAGGTGCCTGG + Intergenic
1079760325 11:24321005-24321027 TACTGGAGCAAGGAGGGGACTGG + Intergenic
1082794496 11:57369654-57369676 AAATGGAGAGGGGAGGTGACGGG - Intronic
1083222154 11:61259440-61259462 TCCTGGAGGCAGGAGCTGGCTGG - Intronic
1083274059 11:61587148-61587170 TGGTGGAGGCTGGAGCTGACTGG - Intergenic
1084089502 11:66870723-66870745 AGCTGGAGGCGGGAGCTGAGAGG - Intronic
1087694168 11:101356722-101356744 TGTTGGAGGAGGGAGGTGATTGG + Intergenic
1088717600 11:112562436-112562458 TATTGGAGGTGGGAGGTGATAGG + Intergenic
1090990689 11:131814650-131814672 AACTGGAGTGGGGAGGTGAGCGG + Intronic
1096655447 12:53088296-53088318 TACTTGAGGGTGGAGGTGAAAGG - Intergenic
1097250702 12:57631030-57631052 TACTGGAGCGGGGAGTTGGCAGG + Exonic
1097669552 12:62519309-62519331 TACTGGGGGTGGGTGGTGAGAGG + Intronic
1100044010 12:90356622-90356644 TTCTGGAGGCTGGTGGCGACAGG - Intergenic
1100420264 12:94425372-94425394 TACTGGAGGCATGATCTGACAGG - Intronic
1101037145 12:100717194-100717216 AGCTGGAGGTGGGAGGTGCCCGG - Intergenic
1102229654 12:111253508-111253530 GAATGGAGTAGGGAGGTGACAGG - Intronic
1103008290 12:117439027-117439049 TACTGGAGGCCGGAGCTGAGGGG - Intronic
1105813561 13:24014092-24014114 TCCTGGAGGCTGGAGGCCACAGG + Intronic
1107833768 13:44397344-44397366 CACTGGAGGCGGGAGGACAACGG + Exonic
1108166140 13:47695233-47695255 TACTGGAGGGAGGGGGTGAAAGG - Intergenic
1108324049 13:49312925-49312947 TGCTGGAGGTGGGAGGGGAAAGG - Intronic
1108439989 13:50441591-50441613 TACTTGAGCCTGGGGGTGACAGG + Intronic
1112697869 13:101970872-101970894 TCCTGGAGGGTGGTGGTGACAGG - Intronic
1115893254 14:38056453-38056475 CACTGGAGGGGGCATGTGACAGG + Intergenic
1118214037 14:63791382-63791404 CAATGGAGGAGGGAGTTGACAGG - Intergenic
1119757399 14:77128784-77128806 TGGTGGGGGCGGGAGGTGTCTGG - Intronic
1121725400 14:96144644-96144666 TACTTGAGGGTGGAGGTGAGAGG + Intergenic
1122897713 14:104768770-104768792 TGCAGGGGGCGGGAGGGGACAGG - Intergenic
1123703735 15:22935617-22935639 TACTGGAGGCAGGAGGAGGAAGG + Intronic
1125666540 15:41435074-41435096 TACTGTAGGCAGGAGGCTACAGG - Intronic
1126252785 15:46588324-46588346 TACTGCTGGGGGGAGGTGGCAGG + Intergenic
1128150799 15:65362470-65362492 TCCTGGAGACAGGAGGTGCCTGG - Intronic
1129184814 15:73899580-73899602 GTCTGGAGGTGGGAGGTGGCGGG + Intergenic
1131090527 15:89621660-89621682 TACTAGAGATTGGAGGTGACTGG + Intronic
1132853992 16:2036713-2036735 TGCTGGTGGCGGCAGGTGAACGG + Exonic
1133323617 16:4930328-4930350 TCCTGCACGCAGGAGGTGACTGG + Intronic
1134120486 16:11580726-11580748 TCCTGGAGGCAGGTGGTGATAGG - Intronic
1135468241 16:22705841-22705863 TGCTGGAGGTGGGAGGTGGGTGG + Intergenic
1136146968 16:28321508-28321530 TTCTGGAGGCTGGAGGGGAGAGG + Exonic
1137727518 16:50667140-50667162 AACTGGAGGCGGGCGGTGCATGG + Intronic
1141655864 16:85416283-85416305 TGCTGGAGGAGGGAGGGGCCCGG + Intergenic
1141670000 16:85486686-85486708 TGCTGGAGGCGGCAGGAGAGAGG - Intergenic
1142122423 16:88393483-88393505 TGCCGTAGGCGGGAGGTGCCTGG + Intergenic
1142760694 17:2040395-2040417 CTCTGGAGGAGGGAAGTGACTGG + Intronic
1142854771 17:2723641-2723663 TGCTGGGGAAGGGAGGTGACAGG - Intergenic
1142904775 17:3034386-3034408 TACTCGAGGAGAGAGGTGAGGGG + Exonic
1143609291 17:8008298-8008320 GACTGGAGGCTGGAGCTGCCAGG + Intronic
1144772406 17:17767078-17767100 TCCTGGAGCTGGGAGTTGACTGG - Intronic
1144941835 17:18947554-18947576 CACTGGAGGAGCGGGGTGACGGG + Intergenic
1146258386 17:31404982-31405004 GGCTGGAGGCAGGAGGTGGCAGG + Intronic
1147062120 17:37888662-37888684 TGTTGAAGGAGGGAGGTGACTGG - Intergenic
1147466142 17:40612775-40612797 CACTGGAGGCGGGTGCTGAAAGG - Intergenic
1147721372 17:42541605-42541627 CACTGCAGGCAGGAGGTGAGTGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149903308 17:60501925-60501947 TCCTGGAGGGGAGAGGGGACAGG + Intronic
1149923200 17:60677966-60677988 GACTGGCGGCGTGAGGGGACTGG + Intronic
1150010508 17:61498315-61498337 TTCTGGAGGTGGGAGGGGAAAGG + Intergenic
1151393080 17:73801087-73801109 CACTGGAGGTGGGAGGAGGCTGG + Intergenic
1152081677 17:78191246-78191268 TACTGGAGGCAGGAGAGGTCCGG + Intronic
1152709208 17:81861857-81861879 TAGTAGAGACGGGAGGTGAGGGG - Intergenic
1152798190 17:82318080-82318102 TCCTGGAGGCGGGAGGTCTGAGG + Intergenic
1156114879 18:33775764-33775786 TACTGGAGCCAGAAGCTGACAGG - Intergenic
1157291440 18:46412615-46412637 TACTGGAGTAGGGAGGAGAGAGG - Intronic
1157698907 18:49747025-49747047 TACAGGAGGGGAGAGGAGACTGG + Intergenic
1157745737 18:50133752-50133774 TCCTGGAGGTGGGAGGGGCCTGG - Intronic
1157752913 18:50194658-50194680 TACTGGAGGCGGGAGGTGACGGG - Intronic
1160010989 18:75107009-75107031 CACTGGAGGCTGTGGGTGACTGG - Intergenic
1160594053 18:79962208-79962230 CTCTGGAGGCGGGAGGAGATGGG - Intergenic
1161815850 19:6499512-6499534 TATTGGAGGCGGGTGGAGCCAGG + Intronic
1161859680 19:6788693-6788715 TTGTGGAGGTGGGAGGTGGCTGG + Intronic
1162695344 19:12469402-12469424 TGATGGAGGCAGGAGGTTACTGG + Intronic
1163319977 19:16568906-16568928 TTGTGGAGGCAGGAGGTCACTGG - Intronic
1163598257 19:18232938-18232960 TCCTGCAGGCGGTAGGTGGCCGG - Exonic
1163674321 19:18647775-18647797 TACTGAAGGCAAGGGGTGACTGG + Intronic
1164996216 19:32721237-32721259 TGCTGGAGGAAGGAGTTGACAGG + Intronic
1165216056 19:34273595-34273617 TCCTGGGGGTTGGAGGTGACAGG + Intronic
1166101893 19:40576237-40576259 AACTGGAGGGGGGAGGAGAGAGG - Exonic
1166911405 19:46160849-46160871 TACTGGAGATGGGAGATGAGTGG - Exonic
1167322739 19:48806527-48806549 TAGTGGAGGCTGGAGGAGGCTGG + Exonic
1167592817 19:50413667-50413689 TACTGGTGTCGGGGGGTGGCAGG - Intronic
928423101 2:31155017-31155039 GATTGGAGGGGGGAGGTGATGGG - Intronic
929449553 2:42027670-42027692 TCCTGGAGGAGAGAGGTGAGTGG + Intergenic
934662112 2:96148556-96148578 CACAGGGGGCGGGAGGTGAGTGG + Intergenic
943798886 2:192033068-192033090 TACTGGGGGCTTGAGGTGAGTGG - Intronic
946045057 2:216814083-216814105 TCCTGAAGGTGGAAGGTGACTGG - Intergenic
946129357 2:217593902-217593924 AAGTGGTGGGGGGAGGTGACCGG + Intronic
946758741 2:222972569-222972591 TCCTGGGGTCGGGAGGTGCCTGG + Intergenic
947487919 2:230569511-230569533 TTCTGGTGGCTGGATGTGACTGG + Intergenic
948269723 2:236664975-236664997 TACAGCAGGAGGGAGGTGATGGG + Intergenic
948604311 2:239125167-239125189 TACTGGAGGTGGGACCTGGCAGG + Intronic
948663648 2:239521488-239521510 GGCTGGAGGCGGGAGGGGCCAGG - Intergenic
1170610633 20:17909961-17909983 TTCTGGAGGCTGGAGGAGACTGG - Intergenic
1172008757 20:31834334-31834356 TGCTGGAGTGGGGAGGTGGCGGG - Exonic
1172205261 20:33158843-33158865 TGCAGGAGGGGAGAGGTGACCGG - Intergenic
1172211928 20:33205890-33205912 TGCTGGAGGTGGGAAGGGACAGG + Intergenic
1172273670 20:33668320-33668342 TCCTGGAGGTTGGAGCTGACTGG + Exonic
1174017681 20:47502005-47502027 AAATGGCGGCGGGAGGTGAGTGG + Exonic
1174136703 20:48385005-48385027 TGCTGTAGGCAGGAGGCGACCGG - Intergenic
1177921938 21:27163313-27163335 TACTAGAGGGGGGAGGAGAGAGG + Intergenic
1179502799 21:41820599-41820621 TCCTGGAGGCGGGAGCTCAGGGG - Intronic
1179925939 21:44534038-44534060 GACTGGAGGGGCGAGGTGAGGGG + Intronic
1181003117 22:19997252-19997274 GACTGCAGGCAGGACGTGACAGG + Intronic
1182738711 22:32549950-32549972 GAAGGGAAGCGGGAGGTGACGGG + Intronic
1184697797 22:46149865-46149887 AACAGGTGGCGGGAGGTGCCAGG - Intergenic
950423921 3:12914538-12914560 GGCTGGAGGTGGGAGGGGACTGG + Intronic
950474493 3:13206980-13207002 ACCAGGAGGCGGGAGGTGCCGGG - Intergenic
952321066 3:32278117-32278139 TACTGAAGGCTGGAGCAGACAGG - Intronic
953091172 3:39727314-39727336 TATTGGAGGTGGGAGGTGATTGG - Intergenic
954634276 3:52063120-52063142 TACTTGAGCCTGGAGGAGACTGG - Intergenic
956232447 3:67031792-67031814 TACTTGAGGGGGGAGGTGGGAGG + Intergenic
956682074 3:71790226-71790248 TAATCCAGGCTGGAGGTGACAGG - Intergenic
958436334 3:94100457-94100479 TACTGGAGGCTGAGGGTGAAGGG + Intronic
962702163 3:138010340-138010362 TACTGGAACACGGAGGTGACGGG - Exonic
964623758 3:158739583-158739605 TACTGGGGGTGGGAGGTGGGAGG + Intronic
965640764 3:170826370-170826392 TACTGGGGGCGGGGGGAGATGGG + Intronic
967978535 3:195049490-195049512 TACTGGAAGCAGGAGTTGAAAGG + Intergenic
968088077 3:195883129-195883151 TACTGCGGGCGGGAGGGGGCGGG - Intronic
968437624 4:602345-602367 GGCCGGAGGAGGGAGGTGACTGG - Intergenic
968964677 4:3763937-3763959 TACTGGGGGCGTGGGGAGACAGG - Intergenic
969484654 4:7465433-7465455 TCCCGGTGGCTGGAGGTGACAGG + Intronic
971151180 4:24033194-24033216 AACTGAAGCAGGGAGGTGACTGG - Intergenic
974819057 4:67043422-67043444 TAGTGGAGGAGGGAGATGATTGG - Intergenic
976248342 4:83025732-83025754 GACTGAAGGGGGGAGGTGCCAGG + Intergenic
976400061 4:84597167-84597189 CACTGAAGGAAGGAGGTGACTGG - Intronic
977154371 4:93554793-93554815 TACCTGAGACGGGAGGTGGCTGG + Intronic
979419718 4:120488739-120488761 TGTTGGAGGAGGGAGATGACTGG - Intergenic
979878330 4:125922470-125922492 TACTTGAGGTGGGAGGTTAGAGG - Intergenic
980677289 4:136102977-136102999 TACTGGAAGCTGAAGGGGACTGG - Intergenic
981104926 4:140869763-140869785 TACAGGTGGCTGGAGGTGATAGG + Intronic
982315444 4:154026218-154026240 TTCTCGTGGCGGGAGGAGACAGG - Intergenic
985668825 5:1196051-1196073 CCCGGGAGGTGGGAGGTGACCGG - Intergenic
986317649 5:6601395-6601417 TGCTGGAGGCGGATGGTGTCTGG - Intronic
987018555 5:13846281-13846303 TACTTGAGGGTGGAGGTGGCAGG - Intronic
987061303 5:14246672-14246694 AACAGGAGGCGAGGGGTGACTGG - Intronic
993653970 5:90555828-90555850 ACCTGGAGGTGGGAGGTGTCAGG - Intronic
995536012 5:113137290-113137312 TATTGAGGGAGGGAGGTGACTGG - Intronic
998157448 5:139795111-139795133 TGAGGGAGGCGGGAGGTGAGGGG - Intergenic
998264126 5:140654276-140654298 TACAGGAAGCAGGAGGTGAAGGG - Intronic
1001746793 5:174098567-174098589 TCCTGGAAGCGAGAGGGGACTGG - Intronic
1002161149 5:177314747-177314769 TGGTGGAGGCAGGAGGTCACAGG - Intergenic
1002637433 5:180615300-180615322 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637470 5:180615447-180615469 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637485 5:180615506-180615528 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637497 5:180615550-180615572 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637520 5:180615639-180615661 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637531 5:180615683-180615705 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637545 5:180615740-180615762 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637558 5:180615785-180615807 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637569 5:180615829-180615851 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637580 5:180615873-180615895 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637593 5:180615918-180615940 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637606 5:180615963-180615985 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637617 5:180616007-180616029 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637628 5:180616051-180616073 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637639 5:180616095-180616117 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637650 5:180616139-180616161 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1003160217 6:3627979-3628001 TCCAAAAGGCGGGAGGTGACAGG + Intergenic
1004538936 6:16530597-16530619 TACTGGAGGGTGGAGGTGGGAGG + Intronic
1005240746 6:23822307-23822329 CCCTGGAGGCAGGAGGTTACAGG + Intergenic
1005358783 6:25010366-25010388 CACTCAAGGCGGGAGGTGAAGGG - Intronic
1006472466 6:34236593-34236615 TTCTGGCGGGGGGTGGTGACGGG - Intergenic
1006568829 6:34983376-34983398 TACTGGAGATGAGAGGTGGCTGG - Exonic
1013633191 6:112005064-112005086 GACTGGAGGAGGGTGGTGTCAGG - Intergenic
1019025557 6:168959930-168959952 GACTGGTGGAGGGAGGTGGCAGG - Intergenic
1019307083 7:340788-340810 CACCGGAGGCGGGAGGGGCCTGG - Intergenic
1019510839 7:1416542-1416564 TGCAGGAGGCAGGAGGTAACTGG + Intergenic
1021571203 7:22067154-22067176 TACTGGAGGTGGAAAGGGACTGG - Intergenic
1023820044 7:43975512-43975534 TGCTGGAGGAGGGAAGTGAGGGG - Intergenic
1024085547 7:45889050-45889072 GAGTGGGGGCGGGAGGTGCCGGG - Intronic
1024477743 7:49831634-49831656 TACTGGAGGTGGGAGGGCAAAGG + Intronic
1024637646 7:51303455-51303477 CACTGGAGGTGAGAGGTGACAGG + Intronic
1024865634 7:53902780-53902802 TACTGGATGTGGGATGTGAGAGG - Intergenic
1026217286 7:68360950-68360972 TATTTGAGCTGGGAGGTGACTGG - Intergenic
1029704769 7:102270455-102270477 AACTGGAGGCTGCAGGGGACAGG - Intronic
1029748323 7:102528965-102528987 TGCTGGAGGAGGGAAGTGAGGGG - Intergenic
1029766270 7:102628052-102628074 TGCTGGAGGAGGGAAGTGAGGGG - Intronic
1031786932 7:126045239-126045261 TAATGGGGGTGGGAGGGGACTGG - Intergenic
1033322436 7:140352145-140352167 TACTGGAGGAGAGGGGTGAAAGG + Exonic
1035255029 7:157620793-157620815 TGCTGCAGGCGGGGGGTGCCGGG + Intronic
1037260348 8:17001485-17001507 TGCTGGGGGCGGGAGGAGAAAGG - Intronic
1037766404 8:21775001-21775023 TCCGAGAGGCGGGAGGTCACCGG + Exonic
1037928888 8:22865680-22865702 TCCGGGCGGCGGGAGGTGGCTGG - Intronic
1039521447 8:38175927-38175949 TACTGCAGGCAGGAGTGGACGGG + Intronic
1039918238 8:41875318-41875340 AACTGGAGGCAGGAGGAGGCAGG + Intronic
1040003362 8:42597687-42597709 AGTTGGAGGTGGGAGGTGACTGG - Intergenic
1040466188 8:47697563-47697585 TCCTGGAGGCGGGAGGAGGGAGG - Intronic
1040948388 8:52909947-52909969 TACTGGATGCAGGAAGAGACAGG - Intergenic
1041537436 8:58942916-58942938 TACTGGTGGTGGAAGGTGAAGGG - Intronic
1041553462 8:59125911-59125933 TCCTGGAGGCTGGAAGTCACAGG - Intergenic
1047308070 8:123669272-123669294 GGCTGGAGGAGGGAGGTGCCTGG + Intergenic
1048223881 8:132566604-132566626 TACTGGAGGGGTGAGGAGCCTGG - Intergenic
1049358791 8:142202030-142202052 TACTGAAGGCGGACTGTGACTGG + Intergenic
1049606241 8:143530477-143530499 TCTTGGTGGCGGGAGGTGATGGG - Intronic
1049655898 8:143797136-143797158 TCCTGGAGGCAGAAGGTGAGGGG + Intronic
1049724778 8:144140657-144140679 TCCTGGAGGCGGGAGACGCCCGG - Exonic
1050699400 9:8320969-8320991 TACTGGAGGGTGTAGCTGACAGG + Intronic
1053203347 9:36167104-36167126 TACTGGGGGTGGGGGGTGAGGGG + Intergenic
1054761281 9:69006441-69006463 TCCTGGGGTCGGGAGGTGAGTGG - Intronic
1057314844 9:93961496-93961518 TGGTGGAGGGGGGAGGTGGCAGG - Intergenic
1057605330 9:96494762-96494784 GACGGGAGGGGGGAGGGGACGGG - Intronic
1059746932 9:117211362-117211384 AACTGGTGGTGGGAGGTGACTGG + Intronic
1060877003 9:127090704-127090726 AAATGGAGGCAGGAGGGGACTGG + Intronic
1062192669 9:135255876-135255898 CACTGGAGGTGGGAGGAGACAGG - Intergenic
1062232983 9:135493010-135493032 TCCTGGAGGCGGGAGGCCATCGG - Intergenic
1062345823 9:136114731-136114753 GACGGGAGGCGGGAGGGGGCTGG - Exonic
1186172929 X:6896638-6896660 TACTGCAGGAGGAAGGTGAAGGG - Intergenic
1187633568 X:21202134-21202156 TACTGGGGGCTGGGGGTGAAGGG + Intergenic
1194966676 X:100296512-100296534 AGGTGGAGGGGGGAGGTGACAGG + Exonic
1194998851 X:100622270-100622292 TACTGGAGGGGTGAGGTGGGAGG + Intergenic
1196168800 X:112564946-112564968 TGTTGGAGGTGGGAGGTGATTGG - Intergenic
1196833022 X:119791252-119791274 TTCTGGAGGCGGGGGGTGGGAGG - Intronic