ID: 1157757858

View in Genome Browser
Species Human (GRCh38)
Location 18:50234547-50234569
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 2, 1: 0, 2: 2, 3: 5, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157757854_1157757858 -10 Left 1157757854 18:50234534-50234556 CCACACCTATGCCTGGTTACAAG 0: 1
1: 1
2: 2
3: 5
4: 77
Right 1157757858 18:50234547-50234569 TGGTTACAAGGTCCCTCCTCAGG 0: 2
1: 0
2: 2
3: 5
4: 91
1157757852_1157757858 -1 Left 1157757852 18:50234525-50234547 CCAAACTAACCACACCTATGCCT 0: 1
1: 1
2: 0
3: 8
4: 99
Right 1157757858 18:50234547-50234569 TGGTTACAAGGTCCCTCCTCAGG 0: 2
1: 0
2: 2
3: 5
4: 91
1157757849_1157757858 28 Left 1157757849 18:50234496-50234518 CCCTCTATTTATGCAAATTATAC 0: 1
1: 0
2: 4
3: 29
4: 301
Right 1157757858 18:50234547-50234569 TGGTTACAAGGTCCCTCCTCAGG 0: 2
1: 0
2: 2
3: 5
4: 91
1157757850_1157757858 27 Left 1157757850 18:50234497-50234519 CCTCTATTTATGCAAATTATACT 0: 1
1: 1
2: 2
3: 21
4: 256
Right 1157757858 18:50234547-50234569 TGGTTACAAGGTCCCTCCTCAGG 0: 2
1: 0
2: 2
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901765074 1:11494884-11494906 TGTTTATAACTTCCCTCCTCTGG - Intronic
902198288 1:14814650-14814672 TGGGTACATGGTGCCTGCTCTGG - Intronic
905023754 1:34836161-34836183 AGGTTACAAGCCACCTCCTCTGG + Intronic
906815004 1:48869708-48869730 TGCTTACAGGCTCCCTCTTCTGG + Intronic
911334672 1:96567788-96567810 TTGTTACAAAGTCCCTGCTTTGG - Intergenic
913234834 1:116770837-116770859 TGGGTTCAAAGTCCTTCCTCTGG - Intergenic
914932345 1:151946478-151946500 TGGTTACATGTTGCCTCCTGAGG + Intergenic
915477675 1:156162613-156162635 TGGTTACACTGTCCCTCCAATGG + Intronic
915632003 1:157159889-157159911 TGGGAACAGGGTCCCTCCTCTGG - Intergenic
918367753 1:183826819-183826841 TGTTTAAAGGGTCCCTCCTTGGG + Intronic
922516288 1:226210608-226210630 TTGTCACAAGTCCCCTCCTCAGG + Intergenic
924895245 1:248331441-248331463 TGGTTACAAGGTCCCACAGTCGG + Intergenic
1071519926 10:86323667-86323689 TGGGTACAGGGTCTCTTCTCAGG + Intronic
1073828950 10:107359623-107359645 TACCTACAAGGTCCATCCTCTGG + Intergenic
1075040324 10:119102945-119102967 TGGCTCCAAGATTCCTCCTCTGG - Intergenic
1076023285 10:127091881-127091903 TGCTTACAGGGTACATCCTCTGG + Intronic
1078508680 11:11969568-11969590 TGGTGAGAAGGACCCTCCTGAGG + Intronic
1083161866 11:60859260-60859282 TGGTTAGAGGTTGCCTCCTCTGG + Intergenic
1083764968 11:64837298-64837320 TGGTGACAAGGCCTCTCCCCAGG + Intronic
1084674195 11:70624626-70624648 TGGTTCCCTGGTTCCTCCTCTGG - Intronic
1088925866 11:114301904-114301926 TGGTTCCAAGCTCACTCCCCAGG - Intronic
1089771908 11:120809106-120809128 TCTTCACAGGGTCCCTCCTCCGG - Intronic
1098218416 12:68243581-68243603 TGGTTACAAAGTCCCTCCTTGGG - Intergenic
1107652471 13:42559250-42559272 TGGTTACAGGGTCCCACTGCTGG - Intergenic
1111988269 13:95087814-95087836 TGGTTCCCAGGTCCCACCTGGGG + Intronic
1112733598 13:102394341-102394363 GGTTTGCAAGGTCACTCCTCCGG - Intronic
1128606780 15:69042531-69042553 TGGTTTGAATGTCCTTCCTCAGG - Intronic
1128934358 15:71732744-71732766 TGGTCACACAGGCCCTCCTCAGG - Intronic
1130124398 15:81080888-81080910 AGGCAACAAGGTCCCTCTTCAGG + Intronic
1130227021 15:82066736-82066758 TGGCAACAAGGGCCCTCCTCTGG - Intergenic
1131244964 15:90783176-90783198 TGGTTTCAATGTCTTTCCTCAGG + Intronic
1131448326 15:92518291-92518313 TTGTAACAAGGTTCCACCTCAGG + Intergenic
1131604750 15:93889681-93889703 TGCTTGCAAGCTCCCTCCTCTGG - Intergenic
1133749545 16:8713725-8713747 TGGGCACCAGCTCCCTCCTCAGG - Exonic
1149494893 17:57111117-57111139 TGGGGACATGGTCCATCCTCAGG - Intronic
1150386410 17:64765159-64765181 GGGTTACAAGGACCTTGCTCCGG + Intergenic
1152691040 17:81717762-81717784 TGGTGACGAGCCCCCTCCTCAGG + Exonic
1156479841 18:37429236-37429258 TGGTTACAAGGACCCTCTATGGG + Intronic
1157304435 18:46506977-46506999 TGATTAGAAGATCCTTCCTCTGG + Intronic
1157757858 18:50234547-50234569 TGGTTACAAGGTCCCTCCTCAGG + Intronic
1157769649 18:50334663-50334685 TGGTTACAAGGTCCCTCCTCAGG - Intergenic
1157974085 18:52306305-52306327 TGGTTACAAGGTCCCACAATAGG - Intergenic
1158457303 18:57619531-57619553 TGGTTAAAAGTTCCTTCCTTGGG - Intronic
1160094498 18:75859597-75859619 TGGTTACCAGGTTCCTCCCCTGG + Intergenic
1161505736 19:4642552-4642574 GGTTTACATGGCCCCTCCTCAGG - Intronic
1161530419 19:4785625-4785647 TGGTTACAATGTGCTTCCTGGGG + Intergenic
1165771266 19:38381743-38381765 TGGGTACAAGGAACCCCCTCAGG + Intronic
1165839432 19:38779014-38779036 TGGTTCCAATGCCCCTCGTCGGG - Intergenic
1166790428 19:45395835-45395857 CAATTACAAGGTCTCTCCTCTGG - Exonic
1167137403 19:47625414-47625436 TGCTTAAATGCTCCCTCCTCGGG + Intronic
929615942 2:43307539-43307561 GTGTTACAAGGTCTCTACTCTGG - Intronic
929780936 2:44956431-44956453 TTGTTTCAAAGGCCCTCCTCGGG - Intergenic
929945296 2:46366841-46366863 TGTTTATAAGGTCGCTCCTACGG - Intronic
932618583 2:73251975-73251997 TGGATGCAAGGTTCCTCCTGTGG - Intronic
944839388 2:203610674-203610696 TGGGTACCAGCTCCCTCCACTGG + Intergenic
946586650 2:221196528-221196550 TGGTGACAAGGCCCATCCTGAGG - Intergenic
948150733 2:235742683-235742705 TGGAGGCAAGGTCCCTCCTGTGG + Intronic
948893582 2:240918278-240918300 TGGGATCTAGGTCCCTCCTCTGG + Intergenic
1173333647 20:42096203-42096225 TGGTTTCCAGGTCTTTCCTCCGG + Intronic
1179618356 21:42596064-42596086 TCGTTTCCAGGCCCCTCCTCTGG - Intergenic
1183660225 22:39215770-39215792 TGATTACAGGGTCCCTTCTTCGG - Intergenic
952916267 3:38246237-38246259 TGGTTTCATGGTCACTCCTTTGG + Intronic
953390194 3:42529560-42529582 TGGTTGGAAAGTCCTTCCTCAGG - Intronic
956980550 3:74632058-74632080 TGGTTTCAAGGTCCCTTCCTTGG - Intergenic
967536980 3:190616472-190616494 TATTTACAAAGTCCCTCCTATGG - Intronic
968814943 4:2817453-2817475 TGGTTTCAAGGCCCCACCTCAGG - Intronic
971538557 4:27785967-27785989 TGATTACAATGTCCCTTCACAGG - Intergenic
977295836 4:95208031-95208053 TGGTTTCCAGATCTCTCCTCGGG + Intronic
977468694 4:97414581-97414603 TGGTTCAATGGCCCCTCCTCTGG - Intronic
978771799 4:112465130-112465152 TGATTACAAGGTCCCACAACAGG + Intergenic
979743626 4:124181538-124181560 TTCTTATAAGCTCCCTCCTCTGG - Intergenic
981846010 4:149170382-149170404 TGGATTCAAGGTCTCTTCTCAGG - Intergenic
985905749 5:2834691-2834713 TGGTTTCAATGTGACTCCTCAGG + Intergenic
986111133 5:4718952-4718974 TGGTGACAAAGTCCCTCCCAGGG + Intergenic
989672668 5:43936697-43936719 TGGTTCCAAGATGCCACCTCTGG + Intergenic
993444873 5:87999053-87999075 TGGTCTCAAACTCCCTCCTCAGG - Intergenic
995852386 5:116559743-116559765 TGGTTCCAAGGTATCACCTCTGG - Intronic
999691011 5:154145865-154145887 TGATTTCAAGCTACCTCCTCTGG + Intronic
1001552201 5:172611193-172611215 TAGTTCCTAGGTACCTCCTCTGG + Intergenic
1009885852 6:69623042-69623064 AGGTTTCAGGGTCCCACCTCGGG + Intergenic
1010107735 6:72188996-72189018 TGGTGACAGGTTCCTTCCTCTGG + Intronic
1012366405 6:98445866-98445888 TGATTACAAGGTCCCTCAATAGG - Intergenic
1013793916 6:113863385-113863407 TGGTTACAAAATACTTCCTCTGG + Exonic
1014747185 6:125214005-125214027 TGGTTCCAAGAACTCTCCTCTGG - Intronic
1017434954 6:154407079-154407101 TGGCCACAAGGTCCCACCTGTGG + Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1024358328 7:48442016-48442038 TGTTTACACAGTCTCTCCTCTGG - Intronic
1024358478 7:48443446-48443468 TGTTTACACCATCCCTCCTCTGG + Intronic
1032383409 7:131505861-131505883 TGCTTACCTGGTCCTTCCTCTGG + Exonic
1033590641 7:142805480-142805502 TGGTCACAAGGCCCCTCCAGTGG + Intergenic
1036980671 8:13466590-13466612 TGTTTACAAGGTGCCTCCATGGG - Intronic
1038098558 8:24344256-24344278 TGGTGATGAGCTCCCTCCTCAGG - Intronic
1048544214 8:135371162-135371184 TGGCTACCAGGTCTCTCCTTGGG - Intergenic
1055241175 9:74188303-74188325 TGATTAAAAAGACCCTCCTCAGG - Intergenic
1057768348 9:97943553-97943575 TTGTCCCAAAGTCCCTCCTCTGG + Intronic
1061932366 9:133839811-133839833 TGTTTACAAAGTCCCTACTGAGG - Intronic
1185558198 X:1037804-1037826 TGATCACAAGGTCCCACCTTAGG - Intergenic
1186374904 X:8988553-8988575 TGGGGACAAGGTCCCTGCACTGG + Intergenic
1197820555 X:130536965-130536987 TGGTTACGAGCTCCCTCCTCAGG + Intergenic
1198523604 X:137476555-137476577 TGCTTTCAAAGTCCCTCCTGTGG + Intergenic