ID: 1157760449

View in Genome Browser
Species Human (GRCh38)
Location 18:50259952-50259974
Sequence TTCTAAGAGCTGTAGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157760449 Original CRISPR TTCTAAGAGCTGTAGCTCTA GGG Intronic
901910406 1:12452825-12452847 TTCTCAAAGCTGTATTTCTAGGG + Intronic
905161075 1:36034896-36034918 TTCTTAGAGCTGGAGCTCTTAGG + Intronic
905852927 1:41287334-41287356 TTTTAAGAGCTGTAGGTCTATGG - Intergenic
907202478 1:52739456-52739478 TTCTATTAGCTGTAGTACTATGG + Intronic
907235453 1:53042165-53042187 TTCTATGAGCTGCCACTCTAAGG + Intronic
908576826 1:65468683-65468705 TTGGAGGAGCTATAGCTCTATGG + Intronic
909259097 1:73464041-73464063 TTCCAGCAGCTGTAGCCCTAGGG - Intergenic
911513537 1:98838648-98838670 TTCTAATATCTGGAGCTCTTGGG + Intergenic
912333192 1:108838028-108838050 TTCTAAGAACTGTGATTCTATGG + Intronic
912650372 1:111433328-111433350 TTCAAAAAGGTGCAGCTCTATGG + Intergenic
913016329 1:114739330-114739352 TTCTAAGAGGTGACACTCTAAGG + Intronic
913115686 1:115694551-115694573 ACCTAAGGGCTGTAGCTCTGTGG + Exonic
919217870 1:194583391-194583413 TTCATGGAGCTGTCGCTCTAAGG - Intergenic
919823915 1:201490413-201490435 TTCTTACAGCTGAAGCTCTCTGG + Intronic
920041830 1:203103074-203103096 TCCTAAAAGCAGTAGCTCTCTGG + Intronic
920788141 1:209062484-209062506 TTCTAAGAGCTGAAGCTGGGAGG - Intergenic
1063997072 10:11629551-11629573 TTCTAAATGTTGTGGCTCTAGGG - Intergenic
1068064744 10:52115411-52115433 TTATAATGGCTGAAGCTCTAGGG - Intronic
1072887156 10:99287971-99287993 TTCTAGAAGCTGTAGCTAAAGGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1078190359 11:9089121-9089143 TTCTCAGACCTGCAGCTCTATGG + Intronic
1083952390 11:65964165-65964187 TTCTAAGAGAGGTGGCTCTGGGG + Intronic
1085157227 11:74306884-74306906 GTCTGTGAGCTGAAGCTCTAGGG + Intronic
1085944977 11:81258490-81258512 TTCTAAGTGCTGTAACTGGAAGG - Intergenic
1086844619 11:91733019-91733041 TTCTAACTGCTGTTGCTTTAAGG - Intergenic
1087034068 11:93738683-93738705 TAATAAGAGCTGTAGCATTATGG - Intronic
1090276393 11:125422687-125422709 TTCTTAGAGCTGCAGCCCTCTGG - Intronic
1094254455 12:28406597-28406619 TTCTAAGAGCAGAAGTTTTAAGG + Intronic
1097471063 12:59991989-59992011 TTCCAAGAGCAGTTGCTCTGTGG - Intergenic
1097537179 12:60887267-60887289 TTTTAACAGCTGTTGCTTTAAGG + Intergenic
1097579878 12:61442150-61442172 TGTTATGAGCTGTGGCTCTAAGG + Intergenic
1098841017 12:75478377-75478399 GTTTTAGAGTTGTAGCTCTAAGG + Intergenic
1101997574 12:109535880-109535902 TTGTAAGAACTTTAGCTCCAGGG + Exonic
1102438533 12:112944210-112944232 CTCTTTGAGCTGTTGCTCTAGGG + Intronic
1103252451 12:119511916-119511938 TTCTAGGATCTGTGGCTCTAGGG + Intronic
1104042999 12:125142671-125142693 TTCTAACAGCTAAAGCTCAAAGG - Exonic
1104275308 12:127321510-127321532 CACTTAGAGCTGCAGCTCTAAGG - Intergenic
1104310928 12:127653772-127653794 TTCTCATAGCTGTGGCTCCAGGG + Intergenic
1105649349 13:22357823-22357845 TTATCAGAGCTGTAGCTTTAAGG + Intergenic
1105822420 13:24091448-24091470 TTCTAACAGCCGTATCTCAAAGG - Intronic
1106755001 13:32813771-32813793 TATGAAGAGCTGAAGCTCTAGGG - Intergenic
1107183521 13:37490113-37490135 TTTTAAGAAATGTATCTCTATGG + Intergenic
1108043018 13:46357027-46357049 TTTAAAGAGATGTAGCTTTAAGG - Intronic
1110278613 13:73666599-73666621 AGCTGAGAGCTGCAGCTCTAGGG + Intergenic
1116886689 14:50229130-50229152 TGCTAAGAGCTGTAGCTCTTAGG - Intronic
1117030023 14:51658998-51659020 TTGTCAGAGCTGTGGCCCTATGG - Intronic
1119553994 14:75539673-75539695 GTCTTAGAGCTGAAGCTCTAGGG - Intronic
1119804485 14:77474037-77474059 ATCTTAGAGCTGTAGTTCTTTGG + Intergenic
1120509669 14:85398113-85398135 ATTTAAGCACTGTAGCTCTAGGG + Intergenic
1121375069 14:93401223-93401245 TTCTAAGATCTGTCTCTCTTTGG - Intronic
1121446568 14:93982628-93982650 TTCCATGAGCTGGAGCTCTCTGG + Intergenic
1124969948 15:34478200-34478222 TTCTTAGAGTTGTGACTCTAAGG - Intergenic
1125256690 15:37772112-37772134 CACTAAGATCTGTAGCTCTGTGG + Intergenic
1140057173 16:71535702-71535724 TTCTGAGATCTGTAGCACTTAGG + Intronic
1143707378 17:8708200-8708222 TTCTAAGAGCTGGACCCCTTGGG - Intergenic
1147040743 17:37716722-37716744 CTCTATGAGCTGTAGCTCTAAGG - Intronic
1148922122 17:51046849-51046871 TGCTAGGAGCAGCAGCTCTATGG - Intronic
1152923285 17:83076520-83076542 TTCTGAGAGCTGTTTCTCGAGGG + Intergenic
1154390572 18:13933033-13933055 GTCTGAGAGCTGCTGCTCTAGGG - Intergenic
1156579117 18:38354985-38355007 TACTAGGAGCTGAGGCTCTATGG - Intergenic
1157760449 18:50259952-50259974 TTCTAAGAGCTGTAGCTCTAGGG + Intronic
1164867353 19:31615702-31615724 TTCTCAGAGATGTTTCTCTAAGG - Intergenic
1167258726 19:48445741-48445763 TTCTGGGAGTTGTAGTTCTACGG - Intergenic
930413316 2:51055131-51055153 CTCTATGAGCTGTAACTCAAGGG - Intergenic
930467072 2:51768551-51768573 TTCTTACTGCTGTAGCTGTAAGG - Intergenic
930938330 2:56983131-56983153 TTCTAGGAAGTGTAGCTCTGGGG + Intergenic
932141150 2:69279377-69279399 TTCTAAGAGCAGTGACTATATGG + Intergenic
933736084 2:85495474-85495496 TTCTAAGAGTGGAAGCTTTAAGG - Intergenic
933859323 2:86449058-86449080 TTTTAAGAGTTGTAGCCTTAGGG + Intronic
935049470 2:99512138-99512160 TTCTTAGAGGCGTAGCTCTCTGG + Intergenic
937766771 2:125670524-125670546 TTCTAAGACCTTTTGCTCAAGGG + Intergenic
937887766 2:126911685-126911707 TTCTGAGAGCTGGGGCCCTATGG - Intergenic
939619072 2:144395655-144395677 ATCCAAGATCTGCAGCTCTATGG - Intronic
940819815 2:158340377-158340399 TTCTGATAGCTCTTGCTCTATGG + Exonic
941734592 2:168959464-168959486 TACTAAGTGCTCTAGCTCTCTGG + Intronic
942442840 2:176053975-176053997 TTCTACAAGCTGTAGGGCTATGG - Intergenic
946820753 2:223627003-223627025 TTCTGAGGGCTGTAGCTGTCAGG - Intergenic
946977573 2:225170254-225170276 TTCTAAGAGCAGTGGCTCCAAGG + Intergenic
947890932 2:233618878-233618900 TGCTAAGAGCATTTGCTCTAGGG - Intronic
1168964330 20:1890126-1890148 GTCCCAGAGCTGTAGCTCCAGGG - Intergenic
1173422249 20:42912071-42912093 TTCTAAAAGCTGCACTTCTAAGG + Intronic
1176027140 20:62991673-62991695 TTCCCAGAGCTGCATCTCTACGG + Intergenic
1177775216 21:25559977-25559999 TCATAAGAGCACTAGCTCTATGG + Intergenic
949390412 3:3556192-3556214 TTCTAGGAGCAGTAGCTGGAAGG + Intergenic
952757189 3:36881115-36881137 TTATATGAGCTGTATCTCAATGG - Intronic
957431932 3:80121555-80121577 GTTTGAGAGCTGCAGCTCTATGG - Intergenic
960858715 3:122129517-122129539 TGCTGAGAGCAGTAGCTCAAAGG + Intergenic
962196823 3:133371099-133371121 TTTTAAGTGCTGGAGCTCAACGG - Intronic
965637863 3:170802454-170802476 TTACAAGAACTGAAGCTCTATGG - Intronic
966508124 3:180730226-180730248 TTTTATGAGGTGAAGCTCTAAGG - Intronic
967920467 3:194610356-194610378 TTCAAAGACCTTTAGATCTAAGG - Intronic
969246411 4:5936014-5936036 CTCTAAGAGCTTTATCTATATGG + Intronic
971558887 4:28048836-28048858 TTCCTAGAGCTTTAGCTTTAAGG - Intergenic
972787254 4:42338114-42338136 TTCCAAGAGCTGTGGATTTATGG + Intergenic
980453840 4:133012956-133012978 TTGTAAGAGCTTTAGATGTATGG - Intergenic
983645397 4:169985282-169985304 TTTAAGGAGCTGTAGCTTTACGG + Intergenic
985208356 4:187565523-187565545 TTCTCAGAGCTGAATCTTTAAGG + Intergenic
985389228 4:189477987-189478009 TTCTCAGCGCTGTATCTCCAGGG - Intergenic
985984405 5:3502720-3502742 TTCTAGGAGCTGCAGCCCAAAGG - Intergenic
986897964 5:12393888-12393910 TTCTAGAAGCTGTAAATCTAAGG - Intergenic
987247305 5:16061463-16061485 TTCTGTGAGCTGCAGCTCTCAGG - Intergenic
990782459 5:59381051-59381073 TTATCAGAGCTCTAGCTCCAGGG - Intronic
992421510 5:76611014-76611036 TTCTAGGAGTTGTAGCTGTAGGG + Exonic
992595314 5:78340800-78340822 ATCTAAGTTGTGTAGCTCTAAGG + Intergenic
993281516 5:85931096-85931118 TTCTAAGGGGTGAAGCTGTAAGG - Intergenic
997170819 5:131718225-131718247 TTCTAATACCTGTAACTCTTTGG - Intronic
997670719 5:135669632-135669654 TTCTAAGAGCCTTAACTCTCAGG + Intergenic
1000954440 5:167525721-167525743 TTCTCAGATCAGGAGCTCTATGG + Intronic
1005210822 6:23460321-23460343 CTTTAGGAGCTGTATCTCTATGG - Intergenic
1006557026 6:34875895-34875917 TTCCAAGTCTTGTAGCTCTAAGG - Exonic
1008947069 6:57110346-57110368 TTCTAGGAGTTGTCTCTCTAGGG + Intronic
1010127629 6:72451402-72451424 TACTGAGAGCTGTAGCTATTTGG + Intergenic
1010369402 6:75089933-75089955 TTCTAAGACATGGATCTCTATGG + Intronic
1013396089 6:109741437-109741459 TTCCAAGAGCTGTTGATCTATGG + Exonic
1014944475 6:127480356-127480378 AATTAAGAACTGTAGCTCTAGGG - Intronic
1016792128 6:148077099-148077121 TTCTAAGAGCAGGAGCCCAATGG + Intergenic
1016877817 6:148881226-148881248 CTCTAAGAGGTTAAGCTCTATGG + Intronic
1017845624 6:158255531-158255553 TTCTTAGAGTTGTTGCTGTAAGG - Intronic
1020220742 7:6234687-6234709 CTGGGAGAGCTGTAGCTCTAGGG + Intronic
1020702106 7:11497692-11497714 TGCTAAGAGCTGTGGCTCTCAGG + Intronic
1023959180 7:44912515-44912537 TTCTAACAGCTGGGGCTCTCAGG + Intergenic
1024485585 7:49914445-49914467 TCCTAAGAGCTAAAGCTCAATGG + Exonic
1028089174 7:86676113-86676135 TGCTAAGAGCTTTAGCTTGAGGG - Intronic
1028257524 7:88618221-88618243 TTTTAGCAGCTTTAGCTCTATGG + Intergenic
1033167749 7:139055745-139055767 TTCTGGTAGCTTTAGCTCTATGG - Intronic
1037517655 8:19649304-19649326 TTCTAAGAGTAGTCACTCTAAGG + Intronic
1042808880 8:72802317-72802339 TTCTAAGAGCAGTGACTATATGG - Intronic
1044665664 8:94632199-94632221 TTCTACTTGCTGTAGCTCTTGGG - Intergenic
1055274227 9:74596094-74596116 TAATAAGAGCTGTAGCACTGAGG + Intronic
1055804970 9:80082444-80082466 TTCTAAAAGCAGTGGCTGTAAGG - Intergenic
1057323829 9:94041179-94041201 TTCAAAGAGCTTTTGCTCAAAGG - Intronic
1058226011 9:102365061-102365083 TTCTAAGAGTGGTAGCTGTTAGG - Intergenic
1059841660 9:118224162-118224184 TTCTAAGAGCCCTTGCTCTTTGG + Intergenic
1061406667 9:130396121-130396143 TGCTGGGAGCTGTGGCTCTAAGG - Intronic
1062084742 9:134642702-134642724 TTTGAAGGGCTGTAACTCTAGGG - Intronic
1187843394 X:23511359-23511381 TGCTAAGAGCTGTGACTCTTTGG - Intergenic
1189952401 X:46246045-46246067 TACTCAGAGCTGCAACTCTATGG - Intergenic
1193441585 X:81546138-81546160 TTGTAAGAGCTGTATCTTTCAGG - Intergenic
1194696676 X:97061241-97061263 TTCTGAGATCTGTTGCTCTAAGG + Intronic
1195682662 X:107560539-107560561 TAGTAGAAGCTGTAGCTCTAGGG - Intronic