ID: 1157762998

View in Genome Browser
Species Human (GRCh38)
Location 18:50277975-50277997
Sequence TGTATCCCCTGCACGAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157762998_1157763008 11 Left 1157762998 18:50277975-50277997 CCCCCTCTCGTGCAGGGGATACA 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1157763008 18:50278009-50278031 CCAGTGGATGCCTGAAACCGTGG 0: 12
1: 182
2: 360
3: 399
4: 417
1157762998_1157763002 -5 Left 1157762998 18:50277975-50277997 CCCCCTCTCGTGCAGGGGATACA 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1157763002 18:50277993-50278015 ATACATCCCAAGTTCCCCAGTGG 0: 1
1: 2
2: 29
3: 218
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157762998 Original CRISPR TGTATCCCCTGCACGAGAGG GGG (reversed) Intronic
900410721 1:2511298-2511320 TGTGTCCCCAGCAGCAGAGGTGG + Intronic
905124384 1:35707163-35707185 TGTGTCCCGTGGATGAGAGGGGG + Intergenic
909480243 1:76122594-76122616 TGTAACCCTTTCATGAGAGGTGG + Intronic
910455563 1:87393978-87394000 TGTTTCCCCTGCAGGACAAGTGG + Intergenic
916362447 1:163985470-163985492 TGTATTCCCTGTAAGAGAGTAGG - Intergenic
917729317 1:177858427-177858449 TGTATCCCCTGCTTGAGATCAGG - Intergenic
921455423 1:215365529-215365551 GCTATGCCCTGCCCGAGAGGTGG + Intergenic
1067015330 10:42753776-42753798 TGTTTCCCCTGCACGGGCGAGGG + Intergenic
1070052849 10:72905786-72905808 TGTATCCCCTCAATGAGATGGGG - Intronic
1075188138 10:120281918-120281940 TGGTGCCCCTGCATGAGAGGTGG + Intergenic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1082765632 11:57165354-57165376 TGTATTCCCTGCATGGCAGGCGG - Intergenic
1084025103 11:66443145-66443167 TGTTTCCCTTGCAGGAGAAGGGG + Intronic
1085055063 11:73398534-73398556 TGTTTCACCTGCACCAGAAGAGG + Intergenic
1088468549 11:110168724-110168746 TGTATCCCATGCAAGAAAGGAGG - Exonic
1090964964 11:131590538-131590560 GGTGTCCCCTGCACGACAAGAGG + Intronic
1091869559 12:3876952-3876974 TGTATCCCCTGCAGATAAGGGGG - Intergenic
1093284964 12:17247671-17247693 TCTATCCCCTACACGACAGTAGG + Intergenic
1096466036 12:51848251-51848273 TGCAGCCCCCGCACCAGAGGGGG + Intergenic
1101590932 12:106124751-106124773 TGTAACCCCAGCACTACAGGAGG + Intronic
1103835756 12:123819495-123819517 TGTATCCCCCACAGGAGTGGAGG - Intronic
1105802607 13:23921733-23921755 TGTAACCACAGCACCAGAGGTGG - Intergenic
1108126888 13:47254458-47254480 TGTATCCCCTGCCCTCAAGGAGG + Intergenic
1110590987 13:77258996-77259018 TGTATTCCCAGCACTTGAGGAGG + Intronic
1113888108 13:113671585-113671607 TGGAGCACCTGCACCAGAGGCGG + Exonic
1118526267 14:66647479-66647501 TGTATCCCTTGCAGAAAAGGAGG - Intronic
1121601620 14:95209196-95209218 TGTATCCCCCGCATATGAGGGGG + Intronic
1123783874 15:23649373-23649395 TGTATCCCCTGCAGGTAAGGTGG - Intergenic
1125755062 15:42057946-42057968 TGTATCCCCACCACTGGAGGAGG - Intergenic
1128555093 15:68626260-68626282 TGTAGCCCCTTCAGGAGGGGAGG - Intronic
1129262075 15:74374188-74374210 TGTATCCCCTGCCCGTGGGGAGG + Intergenic
1135462693 16:22659046-22659068 TGTAACCCCAGCACTTGAGGAGG - Intergenic
1138351298 16:56347602-56347624 TGGATCCCCTCCATGAGAGAGGG + Exonic
1140248239 16:73270741-73270763 TGGATGCCCTGGACCAGAGGCGG + Intergenic
1140346998 16:74222965-74222987 TGTAATCCCTGCACTTGAGGAGG + Intergenic
1140824535 16:78693577-78693599 TGTCTCCACTGCCCTAGAGGAGG - Intronic
1141097873 16:81175629-81175651 CGTGTCCCCTGCACGATTGGTGG + Intergenic
1141909949 16:87052040-87052062 AGCATCTCCTGCACGAGAGCTGG + Intergenic
1145020686 17:19428213-19428235 TGTAACCCCTGCACTTTAGGAGG - Intergenic
1145973926 17:28973471-28973493 TGCCTCCCCTGGACCAGAGGGGG - Intronic
1151437809 17:74108962-74108984 TTTCTTCCCTGCACCAGAGGGGG + Intergenic
1151908942 17:77068768-77068790 CGTATCCACTGCCCAAGAGGAGG - Intergenic
1154092511 18:11378650-11378672 TGTAGTCCCTGCAGGTGAGGCGG - Intergenic
1156325873 18:36074770-36074792 TGTAACCCCAGCACGTCAGGAGG - Intergenic
1157762998 18:50277975-50277997 TGTATCCCCTGCACGAGAGGGGG - Intronic
1165848014 19:38831445-38831467 TGGCTCCTCTGCACAAGAGGAGG - Exonic
1168543525 19:57231727-57231749 TGTAGCCACTGAAAGAGAGGAGG - Exonic
926737539 2:16084754-16084776 TGTAGCCTCTGCCCCAGAGGGGG - Intergenic
927031851 2:19128349-19128371 TGTATCTTCTGCAGGACAGGAGG + Intergenic
929031944 2:37657526-37657548 TGTGTCCCCAGCTCAAGAGGAGG - Intronic
937124524 2:119464965-119464987 TCTGTCCCCTGCAGCAGAGGAGG - Intronic
941784346 2:169481126-169481148 TGTATCTCCTGCACTAGAACGGG - Intronic
942639896 2:178049912-178049934 GCTATACCCTGCACCAGAGGTGG - Intronic
943902969 2:193464790-193464812 TGTATTCCCAGCACTATAGGAGG - Intergenic
946277632 2:218643237-218643259 TGTATCCCCATCACCAGAGCTGG + Exonic
948051129 2:234980167-234980189 TGTATCCCCTGCAGATAAGGGGG - Intronic
1169254754 20:4088492-4088514 TGTATCCCCTGCAAATAAGGGGG + Intergenic
1181855629 22:25779808-25779830 TGTTTCCCCTACACTAGAGCTGG + Intronic
1184478633 22:44735012-44735034 TGTACCCCCTGCAGGAGAGTGGG - Exonic
1184727004 22:46353048-46353070 CGTCTCCCCTCCACAAGAGGTGG - Intronic
954439728 3:50515295-50515317 TGCATGCCCTGCACTGGAGGTGG + Intergenic
967061977 3:185880691-185880713 TGTATCCCCTGCAGATAAGGAGG - Intergenic
967871501 3:194233610-194233632 TGTCTCCTCTGCAAGAGAAGTGG + Intergenic
975125342 4:70776096-70776118 TGTATCCCCTCCACATAAGGGGG - Intronic
979407504 4:120331454-120331476 TGTAGCTCATGCACAAGAGGAGG - Intergenic
988410539 5:30880047-30880069 TGTCTACCCAGCACTAGAGGAGG + Intergenic
990683391 5:58271550-58271572 TCTATCCTGTGCACAAGAGGAGG + Intergenic
990786414 5:59425495-59425517 AATGTCCCCTGCATGAGAGGTGG + Intronic
991502830 5:67294313-67294335 TGTATCATCTTCAGGAGAGGTGG + Intergenic
993108543 5:83627609-83627631 TGTATTCCTTGCAGGAGAGGAGG - Intergenic
997634884 5:135398185-135398207 TGTGGCCCCTGCAGGAGTGGGGG + Intronic
999264063 5:150255177-150255199 TGCAGCCCCTGCACTGGAGGAGG - Intronic
1006106665 6:31721074-31721096 TGTATCCCCTGTATGGGAGGAGG + Intronic
1006165323 6:32061431-32061453 TGTATGGCCTCCACGAGGGGCGG - Intronic
1009367760 6:62868967-62868989 TGTATCCCCTCCTCGATATGGGG + Intergenic
1013550361 6:111202021-111202043 TGGCTCCCCTGTAAGAGAGGTGG + Intronic
1016435654 6:144034508-144034530 TGAACCCCCTGAATGAGAGGAGG - Intronic
1020751385 7:12146094-12146116 TGTAGCTGCTGCACCAGAGGTGG - Intergenic
1021394576 7:20131458-20131480 TGTATCCCCTGCAGATAAGGGGG - Intergenic
1022505320 7:30905914-30905936 AGTTTCCCATGCACCAGAGGAGG + Intergenic
1022635522 7:32130719-32130741 ATTATCTCCTGCACCAGAGGTGG - Intronic
1022679561 7:32531722-32531744 TGCATTCCCTCCACGAGGGGTGG - Intronic
1024761109 7:52597388-52597410 TGAAACCCCTGCACGGGGGGCGG + Intergenic
1026675907 7:72427735-72427757 TGTAACCCCAGCACGTCAGGAGG - Intronic
1028133828 7:87206447-87206469 TGTATCCCCTGCCGGTAAGGGGG - Intronic
1030400115 7:109039051-109039073 TGTATTCCCAGCACTATAGGAGG - Intergenic
1030465369 7:109895144-109895166 TGTAACCCCAGCACTTGAGGAGG - Intergenic
1032496595 7:132367628-132367650 GATGTCCCCTGCATGAGAGGGGG - Intronic
1035460751 7:159037100-159037122 TGTATCCGCGGCTCCAGAGGAGG + Intronic
1038453539 8:27656366-27656388 TGTATCCCCTGCAGGTAAGAGGG + Intronic
1044385179 8:91579445-91579467 TGCATCCCCTGCAGGTAAGGTGG - Intergenic
1045020822 8:98042949-98042971 TGTATCCCTTGCAAGTGAAGGGG + Intronic
1045062247 8:98420533-98420555 TGTATCCCCTGCAGATAAGGGGG + Intronic
1055893277 9:81145878-81145900 TGGAGCCACTGCACGAGAGAGGG + Intergenic
1057251218 9:93504139-93504161 TGTATTCCATGCAGGGGAGGTGG + Intronic
1058830273 9:108810265-108810287 TGTGTCCCGTGGACAAGAGGTGG + Intergenic
1061336359 9:129939942-129939964 TGTAATCCCAGCACTAGAGGAGG + Intronic
1187996305 X:24930688-24930710 GGGATCCCCTGCATGAGGGGCGG + Intronic
1198452578 X:136782133-136782155 TGTCTCCCATGCACGAGGAGAGG - Intergenic
1198775461 X:140174155-140174177 TGTATCCCCTGCAAATAAGGGGG - Intergenic
1200751952 Y:6954252-6954274 TTTATGCCCTGCCCCAGAGGTGG + Intronic
1202345732 Y:23923642-23923664 TGTATCCCCTGCACTTTGGGAGG + Intergenic
1202525039 Y:25746448-25746470 TGTATCCCCTGCACTTTGGGAGG - Intergenic