ID: 1157764358

View in Genome Browser
Species Human (GRCh38)
Location 18:50285781-50285803
Sequence ACTTCTGCCGGATCTTGTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157764342_1157764358 30 Left 1157764342 18:50285728-50285750 CCCAGCTCTGTCCATGCTCACCC 0: 1
1: 0
2: 1
3: 30
4: 347
Right 1157764358 18:50285781-50285803 ACTTCTGCCGGATCTTGTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1157764346_1157764358 19 Left 1157764346 18:50285739-50285761 CCATGCTCACCCGGGCCCGCAGC 0: 1
1: 0
2: 0
3: 24
4: 234
Right 1157764358 18:50285781-50285803 ACTTCTGCCGGATCTTGTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1157764343_1157764358 29 Left 1157764343 18:50285729-50285751 CCAGCTCTGTCCATGCTCACCCG 0: 1
1: 0
2: 2
3: 12
4: 250
Right 1157764358 18:50285781-50285803 ACTTCTGCCGGATCTTGTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1157764348_1157764358 10 Left 1157764348 18:50285748-50285770 CCCGGGCCCGCAGCTGGCACTGG 0: 1
1: 1
2: 0
3: 45
4: 527
Right 1157764358 18:50285781-50285803 ACTTCTGCCGGATCTTGTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1157764351_1157764358 4 Left 1157764351 18:50285754-50285776 CCCGCAGCTGGCACTGGCGCAGC 0: 1
1: 0
2: 2
3: 31
4: 289
Right 1157764358 18:50285781-50285803 ACTTCTGCCGGATCTTGTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1157764350_1157764358 9 Left 1157764350 18:50285749-50285771 CCGGGCCCGCAGCTGGCACTGGC 0: 1
1: 0
2: 1
3: 62
4: 401
Right 1157764358 18:50285781-50285803 ACTTCTGCCGGATCTTGTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1157764352_1157764358 3 Left 1157764352 18:50285755-50285777 CCGCAGCTGGCACTGGCGCAGCC 0: 1
1: 0
2: 7
3: 42
4: 394
Right 1157764358 18:50285781-50285803 ACTTCTGCCGGATCTTGTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157764358 Original CRISPR ACTTCTGCCGGATCTTGTTG GGG Exonic
917649306 1:177061109-177061131 TCTTCTGCCGACTCATGTTGGGG + Exonic
1068055315 10:52005677-52005699 ACTTCTGCCTGAATTTGCTGAGG + Intronic
1083871024 11:65488582-65488604 ACTTCTGCCTGATCTGGCTGGGG + Intergenic
1090574423 11:128085890-128085912 ACTTCTGCTTGAATTTGTTGAGG - Intergenic
1101448781 12:104757332-104757354 ACTTCTGGGTGAACTTGTTGCGG - Exonic
1104978408 12:132562192-132562214 ACTTCTGGGGGATGATGTTGAGG + Intronic
1104987385 12:132604509-132604531 ACTCCTGCGGGCTGTTGTTGCGG + Exonic
1110969271 13:81740415-81740437 ACTTCTGTCAGATCTTGGAGAGG - Intergenic
1113933200 13:113979373-113979395 ACTGCTGCCGGATGTAGTTCTGG + Exonic
1114011093 14:18369430-18369452 ACTTCTTCCTGATTTTGTTGTGG + Intergenic
1115392161 14:32866095-32866117 ACTTCTGCCTGAATTTGCTGAGG - Intergenic
1138345513 16:56317823-56317845 TCTGCTGCAGGATCTTTTTGAGG + Intronic
1140158014 16:72454561-72454583 AATTCTCCCTGATCTTGTTCAGG - Intergenic
1154526744 18:15298547-15298569 ACTTCTTCCTGATTTTGTCGTGG - Intergenic
1156479812 18:37429053-37429075 TCTGCTGCCGTATCTTGGTGAGG + Intronic
1157764358 18:50285781-50285803 ACTTCTGCCGGATCTTGTTGGGG + Exonic
1158740628 18:60138025-60138047 ACATTTGCCAGATCTTCTTGAGG + Intergenic
1162663037 19:12185322-12185344 ACCTGTGCCAGATCTTGTTTTGG + Intronic
1164995283 19:32716746-32716768 ACTTCTCCCAGTTCTTGGTGTGG - Intergenic
932751331 2:74373511-74373533 ACTGCTGCAGGATCTGGTTCTGG - Intronic
938525840 2:132129907-132129929 ACTTCTTCCTGATTTTGTTGCGG - Intergenic
942287636 2:174436381-174436403 ACTTCTGCTGGAACTTTCTGTGG - Exonic
944587548 2:201185918-201185940 ACTTCTCCAGCTTCTTGTTGGGG - Exonic
1174728311 20:52888718-52888740 ACTTCTTCAGCATCTTGGTGAGG - Intergenic
1177320506 21:19513778-19513800 ACTTCTGCCAGAATTTGCTGAGG + Intergenic
1180435587 22:15300234-15300256 ACTTCTTCCTGATTTTGTTGTGG + Intergenic
1180517773 22:16164048-16164070 ACTTCTTCCTGATTTTGTCGTGG + Intergenic
1180702470 22:17789142-17789164 CCTTGTGCCGGATCTTCATGGGG - Exonic
1180903749 22:19393946-19393968 GCTGCTGCCAGATCTTGCTGCGG - Intronic
1181908047 22:26215389-26215411 ACTTCTGCATGTTCTTGGTGAGG + Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
953203238 3:40796805-40796827 ACGTCTTGCTGATCTTGTTGGGG - Intergenic
954403281 3:50330637-50330659 ACTTCTGCAGGATCTGGCGGAGG + Exonic
959484153 3:106908477-106908499 GCTTCTGCCTGCTCTTGTAGTGG - Intergenic
962266595 3:133948575-133948597 GCTTCTCCAGGAACTTGTTGAGG + Exonic
968603898 4:1522529-1522551 ACCTCTGCCGCATCCTGATGTGG + Intergenic
972260447 4:37403024-37403046 ACTTCTTCCTAATCTTTTTGTGG + Intronic
972495968 4:39635123-39635145 TCTTCTCCCAGATCTTGCTGTGG - Intronic
975252842 4:72198993-72199015 ACTTCTCCCCGATCTTGTCCAGG + Intergenic
978775736 4:112505272-112505294 ACTACTGCTGGATATTGTGGAGG - Intergenic
980456323 4:133047994-133048016 ACTTGTACATGATCTTGTTGGGG - Intergenic
999569304 5:152900570-152900592 ACTACTGCAGGATATTATTGAGG + Intergenic
1000409499 5:160923240-160923262 ACTTGTGCATGATCTTGTGGTGG + Intergenic
1001689938 5:173625489-173625511 GCTTCCCCCGGATCTTCTTGGGG + Intergenic
1006571750 6:35011294-35011316 TCTTCTGCCAGTTCTTGTAGTGG - Intronic
1007754476 6:44090125-44090147 ACTTCTGCCTGATCTCGCAGGGG + Intergenic
1015855173 6:137616611-137616633 ACTTCTGCTAGAACTTGTTTGGG + Intergenic
1031224355 7:119016441-119016463 ACTTCTTCCTGATATTGTTCTGG + Intergenic
1043559104 8:81469725-81469747 ACTTCTTCTGCATCTTGTTATGG - Intergenic
1044099944 8:88122807-88122829 ACTTCTGCCATATTTTGCTGTGG - Intronic
1044244729 8:89929159-89929181 AGTTCTGCTTGATCCTGTTGAGG - Intergenic
1046553775 8:115750716-115750738 AGTTCTGCCAGAACTGGTTGTGG - Intronic
1049259217 8:141629760-141629782 TCATCTGCCGGGGCTTGTTGTGG + Intergenic
1050171983 9:2829423-2829445 ACTTCAGCCAGAGCTGGTTGGGG + Intronic
1051891366 9:21945586-21945608 ACTTCTGCCAGAATTTGCTGAGG + Intronic
1053704532 9:40737255-40737277 ACTTCTTCCTGATTTTGTCGTGG - Intergenic
1054414613 9:64860862-64860884 ACTTCTTCCTGATTTTGTCGTGG - Intergenic
1055073740 9:72193399-72193421 AATTCTTCCAGATCTTGTTCAGG - Intronic
1055487461 9:76770614-76770636 AGTTTTGCAGGATTTTGTTGTGG - Intronic
1057563484 9:96147291-96147313 ACTTCTGCCAGATGTGGTGGAGG - Intergenic
1062131445 9:134896200-134896222 ACTTCTGCCACATCTTGGGGTGG - Intergenic
1062131649 9:134897846-134897868 ATTTCTGCCGAATCTTATTCTGG - Intergenic
1187631964 X:21183243-21183265 GCTTGTGTCGGATCTGGTTGAGG - Intergenic