ID: 1157769932

View in Genome Browser
Species Human (GRCh38)
Location 18:50337116-50337138
Sequence ATTTTGTCCTGGGGGCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157769925_1157769932 6 Left 1157769925 18:50337087-50337109 CCTTCAGCTCAAGGCCATCAGGT No data
Right 1157769932 18:50337116-50337138 ATTTTGTCCTGGGGGCCCTTTGG No data
1157769922_1157769932 8 Left 1157769922 18:50337085-50337107 CCCCTTCAGCTCAAGGCCATCAG 0: 6
1: 16
2: 16
3: 26
4: 155
Right 1157769932 18:50337116-50337138 ATTTTGTCCTGGGGGCCCTTTGG No data
1157769923_1157769932 7 Left 1157769923 18:50337086-50337108 CCCTTCAGCTCAAGGCCATCAGG 0: 7
1: 16
2: 18
3: 27
4: 200
Right 1157769932 18:50337116-50337138 ATTTTGTCCTGGGGGCCCTTTGG No data
1157769927_1157769932 -8 Left 1157769927 18:50337101-50337123 CCATCAGGTGTTGGCATTTTGTC No data
Right 1157769932 18:50337116-50337138 ATTTTGTCCTGGGGGCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157769932 Original CRISPR ATTTTGTCCTGGGGGCCCTT TGG Intergenic
No off target data available for this crispr