ID: 1157774284

View in Genome Browser
Species Human (GRCh38)
Location 18:50379470-50379492
Sequence CCTTCCACACACACACTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157774276_1157774284 -4 Left 1157774276 18:50379451-50379473 CCTCAACCTCACTCCCACCCCTT 0: 1
1: 0
2: 12
3: 106
4: 1036
Right 1157774284 18:50379470-50379492 CCTTCCACACACACACTGAAGGG 0: 1
1: 0
2: 3
3: 42
4: 260
1157774275_1157774284 26 Left 1157774275 18:50379421-50379443 CCATATTACAAATTCTGAAAGAG 0: 1
1: 0
2: 1
3: 23
4: 363
Right 1157774284 18:50379470-50379492 CCTTCCACACACACACTGAAGGG 0: 1
1: 0
2: 3
3: 42
4: 260
1157774277_1157774284 -10 Left 1157774277 18:50379457-50379479 CCTCACTCCCACCCCTTCCACAC 0: 1
1: 2
2: 19
3: 215
4: 1655
Right 1157774284 18:50379470-50379492 CCTTCCACACACACACTGAAGGG 0: 1
1: 0
2: 3
3: 42
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157774284 Original CRISPR CCTTCCACACACACACTGAA GGG Intronic
900318992 1:2073256-2073278 CCGTCCCCACACACACTGGTGGG + Intronic
900864796 1:5260593-5260615 CCTTCCACACACTCCATGGAGGG - Intergenic
901275362 1:7986927-7986949 CCTTCCTCTCACACCCTGAGTGG - Intergenic
902112335 1:14092631-14092653 CCTTACACACACACACGCACTGG + Intergenic
902208641 1:14888489-14888511 CTTTCAATACACACACTGGAAGG + Intronic
902364932 1:15966713-15966735 CATTCCACACACACGCAGCAAGG + Intronic
902834843 1:19040392-19040414 TCTGCCACACACAAACTGAGTGG - Intergenic
903345384 1:22681054-22681076 CCTAGCACAGACTCACTGAACGG - Intergenic
904390484 1:30182356-30182378 CCTTCCACACAAACACCTCAAGG - Intergenic
904918440 1:33986927-33986949 CCTTACACACACACACGAGAAGG - Intronic
906035501 1:42748096-42748118 CCTAGCACACACACACTGGTTGG - Intronic
906038120 1:42766017-42766039 GCCCCCACACACACACAGAAAGG + Intronic
906785354 1:48610858-48610880 CCTTCCACACACACACAGCCTGG + Intronic
907032196 1:51183543-51183565 CCTTCCCCAAATACACAGAAAGG - Intergenic
907288287 1:53396106-53396128 CCTCCCCCAAAGACACTGAAGGG + Intergenic
910118737 1:83761131-83761153 CCTTCCAAACACACAGGTAAAGG - Intergenic
911015227 1:93325055-93325077 CCCTCCACATACACACAAAAAGG - Intergenic
912092041 1:106090475-106090497 CCATACACACACACACACAACGG + Intergenic
912334146 1:108846877-108846899 CCTTCCACACCCATTCTAAACGG + Intronic
912545397 1:110447522-110447544 CCTTCTACACAGACACTCAATGG + Intergenic
912737323 1:112161307-112161329 CCCTCCACACACAGACAAAAGGG + Intergenic
913425768 1:118727396-118727418 CTTTCCCCACACACCCTGACAGG - Intergenic
913717816 1:121555637-121555659 ACACACACACACACACTGAAGGG - Intergenic
915512667 1:156394913-156394935 CCTTCCCCGCACACAGTGAAGGG - Intergenic
917455013 1:175178771-175178793 ACTTTCACAACCACACTGAATGG - Intronic
917611891 1:176697035-176697057 ACTGCCACACACACACAAAATGG - Intronic
918582566 1:186148387-186148409 CCTTCCACAGACATTCTTAATGG + Intronic
918674808 1:187270069-187270091 TCCTCCCCACACACACTTAACGG + Intergenic
919064479 1:192676337-192676359 CCTTCCACAAACACACTAAATGG + Intergenic
919522367 1:198604239-198604261 CCTTCTCCACACTCACTGCAAGG + Intergenic
920096455 1:203489377-203489399 TCCTCCAAACACACACAGAATGG + Exonic
920977754 1:210801618-210801640 CCTTCCCCACCCTCACTGTAGGG - Intronic
921525639 1:216214001-216214023 ACTACTACACACTCACTGAATGG + Intronic
1062952198 10:1513070-1513092 CCTACCACATCCACACTGAATGG + Intronic
1063379402 10:5574994-5575016 CCTGCCCCACCCACACTGCAGGG + Intergenic
1063854858 10:10238015-10238037 CCCTGAACACACACACTGACTGG - Intergenic
1064874408 10:19976750-19976772 CCACCCACACACACACAAAAGGG - Intronic
1066054902 10:31671567-31671589 CCCCCCACACACACACAGAGTGG + Intergenic
1066095977 10:32072383-32072405 CCTTTCCCACACTAACTGAAAGG - Intergenic
1067425595 10:46208894-46208916 ACACACACACACACACTGAATGG + Intergenic
1069539239 10:69281225-69281247 CCTTCCACAGACCTACTGAATGG - Intronic
1070567967 10:77618215-77618237 CCCTCCACACACACCATCAATGG + Intronic
1070831247 10:79419315-79419337 CTTTCCACACACACTCTGCAAGG + Intronic
1072700662 10:97639200-97639222 CCTTCCACACCCACACTCTGGGG + Intronic
1074075391 10:110119033-110119055 TCTTCCACACACACACAAAAAGG - Intronic
1078173442 11:8949039-8949061 CCCTCAACACACACACTAAATGG + Intronic
1078457099 11:11483865-11483887 CCATCCAAAAACACACGGAAAGG - Intronic
1079566851 11:21892934-21892956 TCCTCCACACACACACACAATGG + Intergenic
1080308093 11:30858381-30858403 ATCTACACACACACACTGAAAGG - Intronic
1083584606 11:63847638-63847660 CCTTCTCCCCAAACACTGAATGG + Intronic
1085051800 11:73383813-73383835 TCTTCCACACTCACAGGGAAAGG - Intronic
1086700245 11:89893502-89893524 CACGCCACACACACATTGAATGG + Intergenic
1086705924 11:89951014-89951036 CACGCCACACACACATTGAATGG - Intergenic
1087529200 11:99357489-99357511 CCCACCACACACACACTCTAAGG + Intronic
1089247440 11:117132509-117132531 ACATCCACACAAACACAGAAAGG + Intergenic
1089736446 11:120553187-120553209 CACTCCACACACACACTGGCTGG - Intronic
1089797365 11:120992356-120992378 CACCCCACACACACACTGAGAGG - Intergenic
1090414360 11:126530513-126530535 TCTTCCACACACACACTGACCGG + Intronic
1091130460 11:133142678-133142700 ATTTCCACTGACACACTGAATGG + Intronic
1091262781 11:134247011-134247033 CCTTTCCCACACTAACTGAAAGG - Exonic
1092125356 12:6071638-6071660 CCTACCCCACACACAGTGAGTGG + Intronic
1094016889 12:25874366-25874388 CCTCACACACACACACAGGAGGG + Intergenic
1094302229 12:28977870-28977892 TCTTGCTCACACACACTAAAGGG + Intergenic
1095955002 12:47800794-47800816 CCTTCCCCTCACACTCTGCATGG + Intronic
1095962652 12:47845080-47845102 CCACCCACACAGACACTCAACGG + Intronic
1096465985 12:51848079-51848101 CCTCCCACACACACACACAGGGG + Intergenic
1096752450 12:53769903-53769925 CCTCCCACATAGACACTGATAGG - Intergenic
1097244915 12:57602432-57602454 CTGGCCACACACCCACTGAAGGG - Exonic
1097956088 12:65486714-65486736 ACTGCCACAAACACACTCAATGG + Intronic
1099367672 12:81789491-81789513 TCTGCCACACATACACTAAAAGG + Intergenic
1101886968 12:108673026-108673048 CCTTTCACCCAAACACTTAAAGG - Intronic
1102354967 12:112225597-112225619 CCTTCCACAAACAAATTGTAAGG + Intronic
1102858521 12:116315473-116315495 CCTGGCACACACACACTCAGGGG + Intergenic
1103558481 12:121779807-121779829 CATTCCACCCACACACTGTGAGG - Exonic
1104471916 12:129036155-129036177 CCCTTCACACACAGACTTAATGG + Intergenic
1104858932 12:131914871-131914893 CCTCCCACACACCCACTGTGTGG + Intronic
1106107438 13:26745230-26745252 CTCTCCAGACACACACTGAAGGG - Intergenic
1107605291 13:42049482-42049504 CCTTCCACCCACCCTCTGAGTGG - Intronic
1108272282 13:48773268-48773290 CCCCCCACACACACACTACATGG + Intergenic
1109370842 13:61417113-61417135 CACCCCACACACACACTCAAAGG + Intronic
1109879049 13:68447151-68447173 TTTTCCACACACCCACTGAAAGG - Intergenic
1110426758 13:75375769-75375791 CCCCCCACACACACACATAATGG + Intronic
1111394496 13:87647529-87647551 ACTTTCACACACATACTGCAAGG - Intergenic
1111970999 13:94916672-94916694 CCATCCATACACCCAATGAATGG - Intergenic
1112458678 13:99584161-99584183 CATTCCACTCACACACAGAATGG - Intergenic
1113238619 13:108312023-108312045 TGCTCCACAAACACACTGAAGGG - Intergenic
1118111069 14:62720337-62720359 ACTTCCACTCACACATTGAAAGG + Intronic
1118943485 14:70360546-70360568 CCTTTCAAAGACACGCTGAAAGG - Intronic
1119136873 14:72229291-72229313 CCTCCCACACACATACCTAATGG + Intronic
1120484004 14:85087239-85087261 GCTTCCACACACACATTCCAAGG + Intergenic
1121274120 14:92656351-92656373 CCCTCCACACACACCCTTCAGGG - Intronic
1121999455 14:98634850-98634872 CCTGCCACTTACACACTGAAAGG + Intergenic
1122456580 14:101857754-101857776 CCCCCCACACACACACTTACTGG + Intronic
1125839828 15:42789774-42789796 ACTTACACACACACACATAATGG - Intronic
1127327237 15:57907453-57907475 CCTCCCACACACAAATTGCATGG + Intergenic
1127612354 15:60649360-60649382 CCTCCCACACACATATTGAGGGG + Intronic
1128609801 15:69064536-69064558 CCTCCCACACACACTCTCCATGG - Intergenic
1129653891 15:77510180-77510202 TCTTCCAAACACTCACTGGAAGG + Intergenic
1130329582 15:82910955-82910977 CCTACCTCACACAGACTGAAGGG - Intronic
1131806024 15:96123643-96123665 CCCACCACACACACACTGTGAGG - Intergenic
1132302932 15:100787692-100787714 CCTTCCCCACACACCCAGATGGG + Intergenic
1133973244 16:10581504-10581526 CCTTCCACACACACACGATGGGG - Intergenic
1135132731 16:19866281-19866303 GCTTCCACACTCACACACAATGG - Intronic
1136995017 16:35183191-35183213 CCTGTCACGCACACACTGAAGGG + Intergenic
1137393970 16:48104089-48104111 CGATACACACACACACTGACTGG - Intronic
1141867742 16:86762318-86762340 CCCTCCCCACACACACCGCAGGG - Intergenic
1141892980 16:86939599-86939621 CCTGCCACATACAAGCTGAATGG - Intergenic
1142367741 16:89658900-89658922 TCTTCCCCACACACACCCAAAGG - Intronic
1143507588 17:7377117-7377139 CCACCCACACACACACAAAAAGG - Intergenic
1143736073 17:8912873-8912895 CCTACCACAGACACTGTGAAAGG - Intronic
1145044478 17:19602311-19602333 CATTCCTTACACTCACTGAACGG + Intergenic
1145831351 17:27919027-27919049 CCCTCCCCACACACAAAGAATGG + Intergenic
1146377989 17:32307670-32307692 ACCTGCACACACACACTGAGAGG - Intronic
1146666579 17:34709057-34709079 CCTTCCTCACCCACTCTGGAGGG - Intergenic
1146951570 17:36910225-36910247 CCATGCACACACACACTCAGAGG + Intergenic
1148441962 17:47716106-47716128 CTTTCCACCCTCACACTCAAGGG - Intergenic
1149440824 17:56672342-56672364 ACTCCCTCACACACACAGAAGGG + Intergenic
1153527655 18:6013105-6013127 CCTTCCAGTCACTCACTGCAGGG + Intronic
1153710874 18:7797469-7797491 CGTTACACAAACAAACTGAAGGG - Intronic
1155255506 18:23994564-23994586 GCTTACACAAACACACTGAATGG + Intronic
1155265468 18:24088708-24088730 CCATCCCCACAGACACTGAGAGG - Intronic
1155743573 18:29321466-29321488 ACATACACACACACACTGGAAGG + Intergenic
1157119540 18:44895979-44896001 CCTTACACACACTCCCTGATAGG + Intronic
1157439831 18:47702273-47702295 CCTCTCATACACACACTGTAGGG + Intergenic
1157774284 18:50379470-50379492 CCTTCCACACACACACTGAAGGG + Intronic
1158035291 18:53021143-53021165 GCTTCCTCACACACACGGCAGGG + Intronic
1158140127 18:54246742-54246764 CAATACACACACCCACTGAAAGG - Intergenic
1158458069 18:57624730-57624752 CCTTCCACACACACTCAGGTGGG + Intergenic
1159309186 18:66686404-66686426 GCTTCCACACACAAGCTGAAGGG - Intergenic
1160093994 18:75853954-75853976 CCTCCCACACCCACACTGCAAGG + Intergenic
1161905491 19:7153488-7153510 CCACACACACACACAGTGAAGGG + Intronic
1162571658 19:11478032-11478054 CCTCCCACAACCACAGTGAATGG + Intronic
1162836734 19:13324442-13324464 CCTTCCCCACACACAAAAAACGG + Intronic
1164007530 19:21164283-21164305 CCTACCAAACCCAAACTGAACGG - Intronic
1164807092 19:31125348-31125370 CTTTCCACACCCACACATAAGGG - Intergenic
1165526267 19:36357622-36357644 CCTGCCACACACGCACTAAAGGG - Intronic
1166253227 19:41585504-41585526 CCAGCCACACCCAGACTGAAGGG - Intronic
931916298 2:66960523-66960545 CCTTCCACTCACCCACAGGAAGG + Intergenic
932106800 2:68950899-68950921 CTTTCCACGCACACATTGATTGG + Intronic
932315135 2:70775604-70775626 ACATACACACACACACTGAGTGG - Intergenic
934136392 2:89000222-89000244 TCTTTCACACACACACTGGCAGG + Intergenic
935071812 2:99700991-99701013 CACTCCACACTCATACTGAAAGG + Intronic
935527534 2:104189520-104189542 ACCTCCACACCCACACTGCATGG + Intergenic
937124122 2:119462425-119462447 CCTTGCAAACACATAATGAAGGG + Intronic
939181798 2:138811844-138811866 CCTTCCTCTCACTCTCTGAAAGG + Intergenic
939704185 2:145431580-145431602 GCTCACACACACACACTGGAGGG - Intergenic
941021969 2:160417153-160417175 GCATGCACACACACACAGAAAGG + Intronic
944977150 2:205066939-205066961 CCTTCCCCTCACGCACTGCATGG - Intronic
945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG + Intergenic
945227540 2:207547603-207547625 CATTCCAAACACCCACTTAATGG - Intronic
945442371 2:209895262-209895284 CCTTGCATACAGAGACTGAATGG - Intronic
946634081 2:221705351-221705373 CCATCCACACAGGCACTGAATGG + Intergenic
947282046 2:228465959-228465981 CTTTCCACACACACACACAAAGG - Intergenic
948269044 2:236659679-236659701 CTTTGCACAGACACACTGCACGG + Intergenic
948275408 2:236704453-236704475 CTGTACACACACACACAGAATGG + Intergenic
948290991 2:236824427-236824449 ACTTACACACACACACAAAAAGG - Intergenic
1168732486 20:97777-97799 CCTTCCCCACACACCCTGACTGG + Intergenic
1169952434 20:11060286-11060308 CCTGCCACACTAAAACTGAATGG - Intergenic
1171353943 20:24529209-24529231 CCTCCCACACACACAGTCCATGG - Intronic
1172017087 20:31882902-31882924 CCTAACACACACACACAAAAAGG + Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172484968 20:35292406-35292428 CCTGCCACACACACAGCGAGCGG - Intergenic
1172776787 20:37412374-37412396 CCCTACACACACACACTCACAGG + Intergenic
1172921699 20:38488967-38488989 CCTTCCAAACACACTCTAAATGG - Intronic
1173603069 20:44309928-44309950 CCTTCCTCACCCACCCTGAGAGG - Intronic
1173812056 20:45962050-45962072 CCTCCCACCCCCACACTGACCGG + Exonic
1173923179 20:46761190-46761212 TCTTCAACAAACACACTGCAAGG - Intergenic
1174681013 20:52408270-52408292 TTTTCAACACTCACACTGAAAGG - Intergenic
1175342030 20:58238628-58238650 TCTTCCAAACACACACAGACTGG - Intergenic
1177766337 21:25461456-25461478 TCTTGCACACACACACGCAATGG - Intergenic
1179566861 21:42254360-42254382 CCTGCCCCACACTCACTGAGGGG + Intronic
1179803788 21:43824709-43824731 TCTTCCACACCCACACTGCTGGG + Intergenic
1180038981 21:45266093-45266115 CCCTCCACACACACGCTGTATGG + Intronic
1180983749 22:19892035-19892057 CGGTGCACACACACACAGAAGGG - Intronic
1181669450 22:24419389-24419411 CCTTCCTCACAAACACGGGAGGG - Intronic
1182123927 22:27802911-27802933 CCTTCCCTACACACACTTTAGGG - Intergenic
1182394904 22:30028230-30028252 CCTTCCACTCCCCGACTGAAGGG - Intronic
1182772031 22:32802838-32802860 CCCTCCCCACACACATTCAAGGG - Intronic
1182957375 22:34439323-34439345 CCTCCCACACATCTACTGAAAGG + Intergenic
1183111332 22:35650972-35650994 CCTCCCTCACACACTCTGAAGGG - Intronic
1183702108 22:39456856-39456878 CCGTCCACGCATACACAGAACGG + Intergenic
1183732049 22:39623940-39623962 CCTTTCACACACACCCTCACAGG - Intronic
1183936224 22:41263950-41263972 CTTTTCCCACCCACACTGAAAGG - Intronic
1184214460 22:43057582-43057604 CCCACCACACACACACTCCACGG + Intronic
1184864832 22:47196298-47196320 CCTTCCACCCAGACACTGAGAGG - Intergenic
1185147521 22:49147321-49147343 CCCTCCCCACTCACACTGAAAGG - Intergenic
949482104 3:4503686-4503708 CCCACCACACACACACGCAACGG + Intronic
951586876 3:24223877-24223899 CCCCCCACACACACATTGATTGG - Intronic
951717524 3:25664814-25664836 CCTCACACACACACACCGAGAGG + Intronic
951990632 3:28672337-28672359 ACATACACACACACACAGAATGG - Intergenic
952120746 3:30241251-30241273 CCTTCAACTGACACACAGAAAGG + Intergenic
952525771 3:34208931-34208953 CCTCCCACACACCTGCTGAATGG - Intergenic
952947522 3:38488925-38488947 CCTTCCATACACACAAAGAGTGG - Exonic
954034135 3:47841443-47841465 CCTCCCACAGCCACACTGCATGG - Intronic
954906962 3:54071189-54071211 CCACACACACACACACTCAAGGG + Intergenic
955788540 3:62565015-62565037 CCTTACACACACACACGGGGTGG + Intronic
956472337 3:69580277-69580299 ACACACACACACACACTGAATGG + Intergenic
956640903 3:71414445-71414467 CCATCCACACCCACACAGCAGGG + Intronic
958649377 3:96917725-96917747 CATTACACTCACACCCTGAAAGG + Intronic
958964645 3:100545815-100545837 CCTACCACAAAAACACTAAAGGG - Intronic
959902274 3:111674495-111674517 CTGTCTACACACACACTGGAAGG + Intergenic
961253244 3:125523991-125524013 TCATCCACACTGACACTGAAAGG - Intergenic
962290609 3:134133654-134133676 CCTTCTACACACACACTTATAGG - Intronic
962357674 3:134708872-134708894 CCTTCCAGACACACACTCACAGG - Intronic
962411839 3:135147596-135147618 CCTCCAACACACACACTGTATGG + Intronic
962561454 3:136611119-136611141 CCTTACACACACAGCCTGAAAGG + Intronic
963366813 3:144345436-144345458 CCTCCCACACACACATTCAGAGG - Intergenic
963903929 3:150758434-150758456 CCCTAAACCCACACACTGAAGGG + Intronic
964890183 3:161525316-161525338 CCTTCCACACATATAGTGTAAGG + Intergenic
965490399 3:169328082-169328104 ACTTCCTCATAGACACTGAAAGG - Intronic
966903001 3:184500509-184500531 CCTGCCTCCCACACACAGAAAGG + Intronic
967292836 3:187937909-187937931 CCCTCCACACACACACTAAATGG + Intergenic
968452177 4:680924-680946 CCTTCCCAACACACACTCAGGGG - Intronic
969128560 4:4973532-4973554 ACACACACACACACACTGAAAGG - Intergenic
969260006 4:6027443-6027465 CCTGCCACACCCCCACTGGATGG - Intronic
970909754 4:21261193-21261215 CCTTCAACAGAAACACTGAAGGG + Intronic
973205917 4:47560029-47560051 CCTGCCCCACACACAGTTAAAGG + Intronic
976958599 4:90937501-90937523 ACAAACACACACACACTGAATGG + Intronic
977447153 4:97145297-97145319 CCTTCCACACTCAAGGTGAAAGG - Intergenic
979327660 4:119398305-119398327 CCTTTCACCCACATACTGACAGG - Intergenic
981024496 4:140063476-140063498 CCTCCCACACACTCACTGTGGGG + Intronic
981237887 4:142439299-142439321 ACTTCCACACAGAGACGGAAGGG - Intronic
981842368 4:149127488-149127510 AATTCAAGACACACACTGAAGGG + Intergenic
981906400 4:149925988-149926010 CCTTCCCCCCACTCTCTGAAAGG + Intergenic
984101022 4:175485684-175485706 CCTGCCACACACACACAAAAGGG + Intergenic
984843913 4:184093912-184093934 CCTCCCACCCACACACAGCAAGG - Intronic
986624318 5:9709230-9709252 CCTTCCACAGACTCACTCATTGG + Intronic
989305276 5:39947978-39948000 ACTTCCAGTCACACACTGGAGGG - Intergenic
989960751 5:50412268-50412290 ACACACACACACACACTGAAGGG + Intronic
990394276 5:55359747-55359769 CTTTCCACACACACAGTACAAGG - Intronic
990819150 5:59817746-59817768 CCCCCCACACACACACAGAAAGG + Intronic
993090128 5:83415370-83415392 CCATCCTCACACACACTAATAGG - Intergenic
993641315 5:90409575-90409597 CCTTCCACACACACCCTCCCTGG + Intronic
994107542 5:95963001-95963023 CTATCCACACACAATCTGAAAGG - Intergenic
994503894 5:100615534-100615556 CCACCCACACACACACTTAAAGG + Intergenic
996190057 5:120528789-120528811 CCTAACACCCACACGCTGAATGG + Intronic
996661826 5:126012983-126013005 ACTTCCTCAGTCACACTGAAAGG - Intergenic
997260710 5:132463722-132463744 ACTCGCACACACACACTGAGGGG + Exonic
999159954 5:149487187-149487209 CCTGCCACAGACCCACTGAATGG - Intergenic
1000184519 5:158846236-158846258 CCCACCCCACACACACTGGAGGG + Intronic
1002999322 6:2316808-2316830 CCCTCCACACACACACACAGTGG - Intergenic
1003453374 6:6258398-6258420 CCTTCCAAACACACAATCTAGGG + Intronic
1005500258 6:26423066-26423088 CCTTATACACAAACACTGCAGGG - Intergenic
1009713479 6:67355381-67355403 CCTTCCACACAAACAATAAATGG + Intergenic
1010154077 6:72771575-72771597 CTTCCCACACACACAATAAAGGG + Intronic
1010554746 6:77265332-77265354 GTTTCCACACACACTCTAAAAGG + Intergenic
1012149386 6:95727271-95727293 TCTTTCAGATACACACTGAAAGG + Intergenic
1015019729 6:128458597-128458619 ACTTGCACACACACACAAAATGG + Intronic
1017757288 6:157540191-157540213 CCTGCCACACTCTCACTGCAGGG - Intronic
1018889863 6:167976144-167976166 CTCCCCACACACACACTGCAGGG - Intergenic
1021037512 7:15818193-15818215 CCTTCACCACTCACACTGTAGGG + Intergenic
1021075107 7:16293657-16293679 CCATACACGCCCACACTGAAAGG + Intronic
1021342937 7:19487753-19487775 CCTTCCACACCCACACTTCTGGG - Intergenic
1021545415 7:21807767-21807789 CCTTCCACACAGTCACTATAAGG - Intronic
1022732547 7:33043750-33043772 CCTACCACATACACACTGGGTGG - Intronic
1024430875 7:49286399-49286421 CCTTCCAAAAACACAATGAATGG + Intergenic
1029353732 7:100034378-100034400 CCTTCCACACAGCCCCTGCAGGG + Exonic
1029588804 7:101493324-101493346 CCTGCCAGGCAAACACTGAAGGG - Intronic
1032460380 7:132105884-132105906 ACCACCAGACACACACTGAATGG - Intergenic
1033111630 7:138583662-138583684 CCTTCCACACACACTGGTAAAGG - Intronic
1033288828 7:140064065-140064087 CCTGCCACACACACACACACAGG - Intergenic
1035118968 7:156549116-156549138 CCCTCCACACATACTCTGACAGG + Intergenic
1035675982 8:1455776-1455798 CCTTCCGCACACTCACTCAGTGG - Intergenic
1035890683 8:3339228-3339250 CATTCCAAAGAAACACTGAAAGG - Intronic
1035983253 8:4396661-4396683 CCATACACACACACACCCAATGG + Intronic
1036375166 8:8193618-8193640 CCTTTCACAGACAGACGGAAGGG + Intergenic
1036746293 8:11412398-11412420 CTTTCCTCTCACTCACTGAAAGG + Intronic
1036854373 8:12229530-12229552 CCTTTCACAGACAGACGGAAGGG - Intergenic
1036875733 8:12472030-12472052 CCTTTCACAGACAGACGGAAGGG - Intergenic
1038151494 8:24944955-24944977 ACTTCCACAGACACACTCAAGGG + Intergenic
1038808382 8:30814801-30814823 CTTTCCAAACAGACAATGAATGG - Intergenic
1039907327 8:41796708-41796730 CAGGCCACACACACGCTGAAAGG - Intronic
1041440744 8:57893831-57893853 CTTTACACACACACAATGATGGG - Intergenic
1042754560 8:72196423-72196445 CCTTCCACTCACCCACAGCAAGG - Intergenic
1043246590 8:78010866-78010888 CCTTACAGACACACAAAGAAGGG + Intergenic
1043916309 8:85926575-85926597 CCTCACAGACACATACTGAAGGG + Intergenic
1044926743 8:97215653-97215675 CCTTCCACACACTCACTTAGTGG - Intergenic
1045356511 8:101394271-101394293 ACATACACACACACACAGAAGGG + Intergenic
1045536992 8:103039713-103039735 CCCTTCCCACACACACAGAAGGG - Intronic
1046290488 8:112153837-112153859 CCCACCACACACACACACAAAGG - Intergenic
1046556588 8:115780542-115780564 CCCTCCACACAAACACTGAGTGG + Intronic
1046832414 8:118761224-118761246 CATTCCACACAAACACTCATAGG + Intergenic
1056072511 9:83003220-83003242 CCCCCCACACACACCCAGAAGGG + Intronic
1056406557 9:86281615-86281637 CCTTCCACTAAAAAACTGAACGG + Intronic
1057889807 9:98861013-98861035 CCTTGCACACACACACTAGATGG + Intergenic
1061042677 9:128149085-128149107 CCCTCCCCACACCCACAGAAAGG - Exonic
1061466576 9:130785314-130785336 CCAACCACACACACCCTGCAGGG + Intronic
1193563798 X:83053006-83053028 ACATACACACACACACTTAAGGG - Intergenic
1194383440 X:93223267-93223289 CCTTCCACAAAAGCACTGGAAGG + Intergenic
1194912791 X:99667459-99667481 ACTGCATCACACACACTGAAGGG - Intergenic
1195587791 X:106585736-106585758 CCTGCCACACCCATACTCAAAGG + Intergenic
1197125348 X:122939467-122939489 ACACACACACACACACTGAAGGG + Intergenic
1199641624 X:149867959-149867981 CCTTCCAAATACCCATTGAAGGG + Intergenic
1200252224 X:154559746-154559768 CCTTCCACAGCCTCACTGCAGGG - Intronic
1200265544 X:154644670-154644692 CCTTCCACAGCCTCACTGCAGGG + Intergenic
1200875758 Y:8153061-8153083 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1200987042 Y:9312470-9312492 TATTTCACACACACACTGGAAGG + Intergenic
1202035145 Y:20625540-20625562 TCCTCCACACACACACACAAAGG - Intergenic
1202118584 Y:21500727-21500749 CTTCACACACACACACTGGAAGG - Intergenic
1202121036 Y:21524267-21524289 CTTCACACACACACACTGGAAGG - Intronic
1202123487 Y:21547808-21547830 CTTCACACACACACACTGGAAGG - Intronic
1202155521 Y:21881573-21881595 CTTCACACACACACACTGGAAGG + Intronic
1202157969 Y:21905114-21905136 CTTCACACACACACACTGGAAGG + Intronic
1202239729 Y:22754114-22754136 CCTTCCAGACAGAGACTGCAGGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic
1202478068 Y:25282241-25282263 CCTTCCAGACAGAGACTGCAGGG - Intergenic