ID: 1157782884

View in Genome Browser
Species Human (GRCh38)
Location 18:50455943-50455965
Sequence CCTCAAGTATTGGAGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157782879_1157782884 -4 Left 1157782879 18:50455924-50455946 CCATTGTTGACACAGTGTACCTC No data
Right 1157782884 18:50455943-50455965 CCTCAAGTATTGGAGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157782884 Original CRISPR CCTCAAGTATTGGAGGGAGA TGG Intergenic
No off target data available for this crispr